We narrowed to 15,163 results for: GRN
-
Plasmid#222913PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 3 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm2
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 2 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-dErbB3
Plasmid#197356PurposeA knock-out vector for dog ErbB3.DepositorInsertA gRNA targeting the dog ERBB3 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Actb KI
Plasmid#183429PurposeCreOFF knock-in for GFP-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Nectin-2
Plasmid#170295PurposeA knock-out vector for the mouse Nectin-2DepositorInsertA gRNA targeting the mouse Nectin-2 gene.
UseCRISPR and LentiviralAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Necl-5
Plasmid#170294PurposeA knock-out vector for the mouse Necl-5DepositorInsertA gRNA targeting the mouse Necl-5 gene.
UseCRISPR and LentiviralAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-mfn2 guide
Plasmid#121993PurposeAn entry vector with U6a and U6c promoter driving mfn2 guide RNAs expressionDepositorInsertmfn2 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-mfn2 guide#2
Plasmid#121994PurposeAn entry vector with U6a and U6c promoter driving mfn2 guide RNAs expressionDepositorInsertmfn2 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-opa1 guide
Plasmid#121995PurposeAn entry vector with U6a and U6c promoter driving opa1 guide RNAs expressionDepositorInsertopa1 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050V (wingless)
Plasmid#132424Purposeexpress arrays of gRNA targeting Wingless under dU6-3 promoterDepositorInsertwingless gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050Z4 (yellow)
Plasmid#132425Purposeexpress arrays of gRNA targeting Yellow under dU6-3 promoterDepositorInsertyellow gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1884
Plasmid#154332PurposesgRNA Target Vector for CRISPRDepositorInsertcxTi10882 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
gh156
Plasmid#106823Purposeexpression of gRNA targeting GYLT1B (LARGE2)DepositorInsertGYLT1B (LARGE2)
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
PX458_MIER3_2
Plasmid#86324PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RFXANK_2
Plasmid#86365PurposeEncodes gRNA for 3' target of human RFXANKDepositorInsertgRNA against RFXANK (RFXANK Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RFXANK_1
Plasmid#86364PurposeEncodes gRNA for 3' target of human RFXANKDepositorInsertgRNA against RFXANK (RFXANK Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_1
Plasmid#86323PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KAT7_1
Plasmid#86309PurposeEncodes gRNA for 3' target of human KAT7DepositorInsertgRNA against KAT7 (KAT7 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE1643
Plasmid#219650PurposeGeneration of nonsense mutation W241* in DesD, disrupting desferrioxamine biosynthesis by base editing CRISPRDepositorInsertgRNA targetting desD in Streptomyces
UseCRISPRAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-ZNF865-UbC-DsRed-P2A-Bsr
Plasmid#241309PurposeLentiviral SpCas9-gRNA (ZNF865) expression vector with DsRed-Express2-P2A-BlastRDepositorInsertZNF865 gRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgNon-targeting
Plasmid#233244PurposeKnock out - non targeting controlDepositorInsertnon targeting control sgRNA
UseLentiviralAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ105
Plasmid#208859PurposeExpresses SoxS activation domain and gRNA targeting 105 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 105
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRRv2_sgTom
Plasmid#218346PurposeCRISPR KO plasmid for tdTomato in human cell linesDepositorInsertInserted sgRNA targeting tdTomato
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-GeneTRAP
Plasmid#218187PurposeTo KO and genetrap mouse Vamp2 simultaneouslyDepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-Tag-HA
Plasmid#218188PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-dUG-D01
Plasmid#138962PurposeUsed in the editing of Drosophila kkvDepositorArticleInsertD01 oligo
UseCRISPR; To synthesize grnaAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN1
Plasmid#194439PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout CEN1DepositorInsertgRNA targeting CEN1
UseCRISPRExpressionPlantPromoterMtU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJF144_SECGFP_sg2
Plasmid#163865PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting GFP
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF143_SECGFP_sg1
Plasmid#163864PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting GFP
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9n-Nanog-L
Plasmid#122302PurposeExpresses sgRNA targeting mouse Nanog and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY131
Plasmid#130956PurposeEngineered sgRNA-LEB2 generator including Anderson promoter J23100 for golden gate assemblyDepositorInsertsgRNA-LEB2
UseSynthetic BiologyExpressionBacterialPromoterAnderson promoter J23100Available SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY74
Plasmid#130945PurposeEngineered sgRNA-G6 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-G6
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-