We narrowed to 14,245 results for: cas9
-
Plasmid#165602PurposeExpresses Sp dCas9 fused to truncated human MSK1 (42-802)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated human Mitogen- and stress-activated protein kinase-1 (42-802) (RPS6KA5 S. Pyogenes, Human, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9-2A-Cre
Plasmid#68468Purposeco-expressing Cas9 and Cre recombinaseDepositorInsertCas9 and Cre recombinase
UseCRISPRTagsP2A-Cre-MycExpressionMammalianPromoterCAGAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pLAT1_Cas9
Plasmid#104907PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pPFK300_Cas9
Plasmid#104910PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-eCas9
Plasmid#140237PurposeLentiviral vector for expression of high-specificity eSpCas9(1.1) and sgRNA scaffoldDepositorTypeEmpty backboneUseCRISPR and LentiviralTags3xFLAGExpressionMammalianPromoterEF-1a coreAvailable SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
L1_Cas9-Ck4
Plasmid#136135PurposeL1 in position 4, for AtcoCas9 (Puchta) expression in L2 CRISPR vectorsDepositorInsertp5-MpEF1a:Cas9_3tNos-35S
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu_Cas9
Plasmid#216423PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter and the Cas9 nuclease for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-SaCas9
Plasmid#178901PurposeSaCas9 (Cas9 from Staphylococcus aureus)DepositorInsertSaCas9
TagsHis6-Tag, bipartite nuclear localization signal f…ExpressionBacterialAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRS-dCas9
Plasmid#220193Purposemini-Tn7 dCas9 expression vectorDepositorInsertPseudomonas aeruginosa-codon optimized Streptococcus pyogenes dCas9
UseCRISPRExpressionBacterialMutationPseudomonas aeruginosa codon optimizedPromoterpromoterlessAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
BB3cN_pGAP_23*_pLAT1_Cas9
Plasmid#104906PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on NTCDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceFeb. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
KRAB-dSpCas9
Plasmid#205248PurposeIn vitro transcription plasmid for production of KOX1 KRAB-dSpCas9 mRNA for transcriptional repression (KRAB = Krüppel-associated box). Insert is derived from Addgene plasmid #85449.DepositorInsertKRAB-dSpCas9
UseCRISPRAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 S. Pyogenes, Human, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-GFP
Plasmid#181906PurposeFluorescently tagged dead Cas9DepositorInsertdCas9
UseCRISPRTagsGFPExpressionMammalianPromoterCMVAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnCas9-PBE
Plasmid#98164PurposeExpresses CRISPR base editor in protoplastsDepositorInsertNLS-APOBEC1-XTEN-nCas9-UGI-NLS
ExpressionPlantPromoterUbiAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9-CAT
Plasmid#80323PurposeEncodes Cas9 and chloramphenicol acetyltransferase (CAT)DepositorInsertsCas9
Chloramphenicol acetyltransferase
UseCRISPRTags3X FLAG and NLSPromoterTgTUB1Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.dCas9-KRAB.P2A.BSD
Plasmid#90332PurposeCRISPR interferenceDepositorInsertsdCas9
na
SFFV
P2A-BSD
UseLentiviralTagsHAAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hCas9
Plasmid#51142PurposeExpresses hCas9 under the CAG promoter for CRISPRDepositorInserthCas9
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAGAvailable SinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-spCas9-SB
Plasmid#169919PurposeExpression of SpCas9-SB100X transposase fusion protein to enhace site-specific DNA integration.DepositorInsertSpCas9-SB100X
UseCRISPRPromoterCAGAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only