We narrowed to 2,417 results for: CAG promoter
-
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTalpha1-Dre
Plasmid#133925PurposeNeuron-specific expression of DreDepositorInsertHA-Dre
UseTagsHAExpressionMammalianMutationPromoterCAG promoterAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT224_(pCA-tTA2)
Plasmid#36430DepositorInserttetracycline transactivator
UseTagsExpressionMammalianMutationPromoterCAG (chicken beta actin promoter and CMV enhancer)Available sinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIE043 ZF43x1 mKate2 (TUPV1)
Plasmid#138723PurposemMoClo TUPV, with ZF43x1 promoter and mKate2 in the MCSDepositorInsertZF43x1
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF43x1Available sinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE042 ZF43x0 mKate2 (TUPV1)
Plasmid#138722PurposemMoClo TUPV, with ZF43x0 promoter and mKate2 in the MCSDepositorInsertZF43x0
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF43x0Available sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRTagsExpressionPlantMutationPromoterAtU6-26 and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tTA
Plasmid#149363PurposeAAV-mediated and Cre-dependent expression of tTA under the CAG promoter.DepositorInserttTA2
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18
Plasmid#68827PurposeExpresses c-myc-tagged human RAD18DepositorInsertc-myc tagged human RAD18 (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
UseTagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRTagsExpressionPlantMutationPromoter2x35S promoter and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197960PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by UBQ10 gene promoter and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRTagsExpressionPlantMutationPromoterpUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
UseTagsExpressionYeastMutationWTPromoterpGPDAvailable sinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-GFP-sg
Plasmid#194717PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target GFPDepositorArticleInsertAsCpf1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorInsertPromoter of RRT8 (RRT8 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
UseTagsExpressionPlantMutationPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUB-GFP
Plasmid#11155PurposeMammalian expression vector for expression of GFP (Ubiquitin C promoter)DepositorUseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GFP
Plasmid#11153PurposeMammalian expression vector for expression of GFP (CMV promoter)DepositorHas ServiceCloning Grade DNAInsertCMV promoter-EGFP
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCralbp-DsRed
Plasmid#11158DepositorInsertCralbp promoter (Rlbp1 Mouse)
UseTagsDsRed2ExpressionMammalianMutationPromoterAvailable sinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL39
Plasmid#166078PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL39 for double stranded break formation in yeast.DepositorInsertPromoter of RPL39 (Overlaps with 5'UTR and first base of gene) (RPL39 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL0-MtBCP1Pro
Plasmid#159415PurposeMedicago truncatula BCP1 promoter sequence (1108 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertMtBCP1 Promoter
UsePuc19-derivedTagsExpressionBacterialMutationPromoterAvailable sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCKC764
Plasmid#226625PurposepiggyBAC pCAG-hCas9-T2A-Unbiased3DepositorInsertsCAG promoter, SpCas9, T2A, Unbiased3 variant of TdT (DNTT S. pyogenes, Human, Chicken)
EF1a promoter, blasticidin resistance
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMV and EF1aAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianMutationPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
BLBP-mCherry
Plasmid#63721PurposeExpressing mCherry from BLBP promoter which is a neural stem cell (radial glial cells) specific promoterDepositorInsertBLBP (Fabp7 Mouse)
UseTagsExpressionMammalianMutation1700 bp upstream of BLBP gene cloned in CAG-mCher…Promoter1700bp upstream of BLBP geneAvailable sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianMutationPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dSAP
Plasmid#68830PurposeExpresses c-myc-tagged human RAD18 deleting SAP domainDepositorInsertc-myc tagged human RAD18 deleting SAP domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dC2
Plasmid#68831PurposeExpresses c-myc-tagged human RAD18 deleting Polymerase eta binding domainDepositorInsertc-myc tagged human RAD18 deleting Polymerase eta binding domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 d6BD
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-A
Plasmid#85216PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-A
UseRetroviralTagsExpressionMammalianMutationPromoterH1Available sinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-B
Plasmid#85217PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-B
UseRetroviralTagsExpressionMammalianMutationPromoterH1Available sinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut AP-1+C/EBP
Plasmid#61292Purposedrives luciferase from mouse IL-6 promoter with mutations in both AP-1 & C/EBP sitesDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseTagsExpressionMammalianMutationMutated both AP-1 binding site from TGAGTCT to TG…PromoterIL-6 promoter with mutant AP-1 and C/EBP binding …Available sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA3
Plasmid#160213PurposeKnock Down MYDSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA3 targeting collybistin MYD-CBSH3- isoforms (Plasmid #160212)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiTagsExpressionMutationTGTATGACCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable sinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA2
Plasmid#160211PurposeKnock Down MTLSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA2 targeting collybistin MTL-CBSH3-isoforms (Plasmid #160210)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiTagsExpressionMutationTGACGTTGCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable sinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiTagsExpressionMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable sinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRTagsExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-SpCas9D10A nickase
Plasmid#216736PurposeExpresses SpCas9-D10A nickase from a nEF promoter. For AAV packaging. Derived from pAAV-nEF-SpCas9 (Addgene #87115)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRTagsExpressionMammalianMutationD10APromoterEF-1-alpha coreAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-ERT2CreERT2
Plasmid#149433Purposetamoxifen-inducible Cre recombinaseDepositorInsertERT2-Cre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-CreERT2
Plasmid#149434Purposetamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pART (pT-2)
Plasmid#62708PurposeMammalian expression of tdTomato from the broadly active CAG promoter/enhancerDepositorInserttdTomato
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-FlpERT2
Plasmid#149435Purposetamoxifen-inducible Flp recombinaseDepositorInsertFlp-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE046 ZF43x12-C mKate2 (TUPV1)
Plasmid#138726PurposemMoClo TUPV, with ZF43x12-C promoter and mKate2 in the MCSDepositorInsertZF43x12-Compact
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF43x12-CompactAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only