We narrowed to 23,934 results for: crispr
-
Plasmid#77948Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PKN3 gRNA (BRDN0001146747)
Plasmid#77949Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001487150)
Plasmid#77950Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM28 gRNA (BRDN0001162440)
Plasmid#76140Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001146969)
Plasmid#77982Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Loop2-8A8G
Plasmid#157983PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001147151)
Plasmid#76461Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001147212)
Plasmid#76463Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pROS16
Plasmid#107930PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHS1232
Plasmid#205969PurposeMWEE01000013 Cas5-HNH operon (E. coli codon optimized) + CRISPR array in pACYCDuet-1 Lac promotersDepositorInsertCas5-HNH proteins and CRISPR array
ExpressionBacterialPromoterLac (proteins), pJ23119 (crRNA)Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGAL4-4
Plasmid#46916PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter (negative control)DepositorInsertssgGAL4-4
Puromycin resistance and mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCfB3051(gRNA X-3 XI-2 XII-2)
Plasmid#73293PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001147987)
Plasmid#76075Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA pDEST40 Cas9-HMGB1
Plasmid#183195PurposeExpression cloneDepositorInsertHMGB1
UseCRISPRTagsCas9WTExpressionMammalianMutationn/aAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001144909)
Plasmid#76890Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCK668
Plasmid#192637PurposeExpresses dCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dCas9-NG ha…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQCas12j2
Plasmid#189780PurposeGateway entry plasmid (attL1 & attR5) expressing NLS-Cas12j2-NLS, without promoterDepositorInsertCas12j2
UseCRISPR; Gateway compatible cas12j2 entry cloneTagsNLSExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only