We narrowed to 2,903 results for: GFP reporter gene
-
Plasmid#223510PurposeFluorescent reporter plasmid for genetic code expansion which consists of a modified GFP with a Amber stop codon on position Y39DepositorInsertGFP(Y39TAG)
Tags6xHis and FLAGExpressionBacterialMutationY39TAGAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBS838 TDP43 RRM-GFP
Plasmid#98249PurposeTDP43 RRM-GFP reporter constructDepositorInsertTARDBP (TARDBP Human)
TagsInternal GFP to replace RRM domainsExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-PNGT3-d2EGFP_CMV-mCherry
Plasmid#213765PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertPNGT#3-d2EGFP
UseSynthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQL47 EGFP-VAMP-GST
Plasmid#122971PurposeReporter of botulinum toxin B cleavageDepositorInsertEGFP-VAMP3-GST
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Fireworks GFP[PTC-] (AVA2598)
Plasmid#85445PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Fireworks GFP[PTC+] (AVA2600)
Plasmid#85446PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a PTC-containing beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)(PTC39)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-MGT1-d2EGFP_CMV-mCherry
Plasmid#213763PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#1-d2EGFP
UseSynthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMx PylT C41CA_GFP 150TAG
Plasmid#140017PurposePlasmid with 4xMxPylT C41CA cassette and amber suppression reporter sfGFP 150 TAG stop; for transient transfection or stable piggyBac-mediated integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAGPromoterEF1Available SinceMay 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT sfGFP 150TAG
Plasmid#154771Purposeplasmid with 4xhybrid PylT cassette (Mx1201 G1 PylT hybrid ) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAGPromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(1-500)-H2B-GFP
Plasmid#236162PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 500 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-MGT4-d2EGFP_CMV-mCherry
Plasmid#213764PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#4-d2EGFP
UseSynthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-CLGT3-d2EGFP_CMV-mCherry
Plasmid#213766PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertCLGT#3-d2EGFP
UseSynthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-MYO5C
Plasmid#135404PurposeExpresses GFP-tagged human MYO5C in mammalian cells.DepositorInsertMYO5C (MYO5C Human)
TagsEGFPExpressionMammalianMutationRelative to the GenBank MYO5C cDNA sequence repor…PromoterCMVAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
PylT(AGGA)Ev2 PylS mCherry-P2A-eGFP(AGGA)
Plasmid#174528PurposeDual-fluorescence reporter for quantifying PylT(AGGA)Ev2 decoding efficiencyDepositorInsertPylS
TagsFlagExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-PI35P2
Plasmid#92419PurposeFluorescent reporter for phosphatidylinositol (3,5)-bisphosphate (PI(3,5)P2). Mouse MCOLN1 residues 1–68 fused to eGFP.DepositorInsertMCOLN1 (Mcoln1 Mouse)
TagseGFPExpressionMammalianMutationSynthetic gene, codon optimized for human.PromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-CoV2-WT
Plasmid#177618PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshiftingDepositorInsertSARS-CoV-2 FSE
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Zed_vector_tol2_+15.2prox1a:EGFP_XCA:DsRed2
Plasmid#218206PurposeZebrafish +15.2prox1a enhancer reporter in the FCLV from 3 dpf. XCA:DsRed2 as a control in the skeletal and cardiac muscle. Shows the high background typical of the ZED vectorDepositorInsert+15.2prox1a
UseZebrafish expressionAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-99a
Plasmid#169304PurposeConstitutive overexpression of miR-99a with GFP as a reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-CI
Plasmid#196849PurposeExpression of green fluorescent reporter AcGFP driven by the strong Beta-actin promoterDepositorInsertAcGFP
ExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.dTomato.miR-ctrl.PGK.sfGFP.P2A.Tet3G
Plasmid#169316PurposeDoxycycline-inducible expression of miR-ctrl with dTomato as reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsdTomatoPromoterTREAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-ctrl
Plasmid#169305PurposeConstitutive overexpression of miR-ctrl with GFP as a reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsEGFPPromoterSFFVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-Thy1.2-P2A-GFP-T2A-Nef
Plasmid#126553PurposeReplication incompetent HIV with H13L Tat and GFP-t2a-Thy1.2 reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsThy1.2 and GFPPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(H66)
Plasmid#63558PurposeExpression of the Azure (blue) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(H66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-EOS-S(4+)-EGFP
Plasmid#21317PurposeLentiviral EOS reporter with Sox2 enhancer (x4), expresses EGFPDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralExpressionMammalianPromoterEOS-S(4+) promoter regionAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-EOS-C(3+)-EGFP
Plasmid#21318PurposeLentiviral EOS reporter with Oct3/4 enhancer (x3), expresses EGFPDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralExpressionMammalianPromoterEOS-C(3+) promoter regionAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-QUAS5x:GFPNLS-SV40pA
Plasmid#155122PurposeTol2 vector containing QUAS5x reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertQUAS5x:GFPNLS
UseZebrafish expressionPromoterQUAS5x-E1bAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Y203)
Plasmid#63559PurposeExpression of the Mostaza (yellow) spectral variant of eGFP in bacteria and in mammalian cells. Used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Y203)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged threonine at position 203 with respect to…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-EGFP
Plasmid#65282PurposeTNF reporter only (no hook) (RUSH system)DepositorAvailable SinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCK074 p5E exorh:EGFP
Plasmid#195951PurposeGateway p5E vector with reporterDepositorInsertexorh:EGFP
UseOtherAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
p1.1-Tr2-eGFP
Plasmid#162782PurposeFluorescent reporter for protein expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Stop66)
Plasmid#63218PurposeExpression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Stop66)
UseLentiviralTagsT7 and his6ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(W66)
Plasmid#63217PurposeExpression of the Celeste (cyan) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(W66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-NeoCOVGT3-d2EGFP
Plasmid#201446PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT3_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-APEX.NES-P2A-EGFP
Plasmid#182824PurposeCre-dependent expression of cytosolic APEXDepositorInsertAPEX.NES-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-H2B.APEX-P2A-EGFP
Plasmid#182825PurposeCre-dependent expression of H2B-APEX fusionDepositorInsertH2B.APEX-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS315-ADH700p-yeCherry-p150-yeGFP-CYCt
Plasmid#194519PurposeDual fluorescence reporter for studying protein degradationDepositorInsertTIF4631 leader sequence
ExpressionYeastAvailable SinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-LckAPEX-P2A-EGFP
Plasmid#182826PurposeCre-dependent expression of membrane localized APEXDepositorInsertLckAPEX-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHBS1292 TDP43 RRM-GFP G368W+W385G
Plasmid#107838PurposeTo test the effect of sequence on TDP43 droplet propertiesDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationG368W and W385G mutations in LLPS reporterAvailable SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only