We narrowed to 2,417 results for: CAG promoter
-
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyTagsExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pstb-LAFR5
Plasmid#86169PurposepLAFR5 with Smb21651 promoter. pLAFR5 is a broad-host range cosmid vector with double cos sites.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterSMb21651 promoterAvailable sinceFeb. 6, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEF-GFP
Plasmid#11154PurposeMammalian expression vector for expression of GFP (EF1a promoter)DepositorUseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pNdrg4-DsRed
Plasmid#13766DepositorInsertNdrg4 promoter
UseTagsDsRed2ExpressionMammalianMutationPromoterAvailable sinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgSTAT3-1
Plasmid#121425PurposesgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgSTAT3-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorInsertSpc25 shRNA (Spc25 Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterU6Available sinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyTagsExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable sinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC43
Plasmid#104817PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from Gmubi promoter from rolD promoterDepositorInsertGlyma.04g057400
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
Plasmid#178102PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_E2419K_Dual_pegRNA
Plasmid#173209PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR E2419K pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralTagsExpressionMutationV30MPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralTagsExpressionMutationV30MPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralTagsExpressionMutationV30MPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK389
Plasmid#206791PurposeSp.dCas9, pTet.MCP-SoxS, J23119.gRNADepositorInsertsdCas9
MCP-SoxS
scRNA
UseTagsExpressionMutationPromoterJ23119 and TetAvailable sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
UseTagsExpressionYeastMutationWTPromoterpGPDAvailable sinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterU6 and synthetic Probasin ARRx2Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#173211PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + MTOR Nick exon-53 sgRNA
UseCRISPR; Prime editing (pe3)TagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA
Plasmid#173212PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +4 T to G pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+1_ATGins_Dual_pegRNA
Plasmid#173213PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +1 ATG insertion pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRho-DsRed
Plasmid#11156DepositorInsertrhodopsin promoter (RHO Bovine)
UseTagsDsRed2ExpressionMammalianMutationPromoterAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut C/EBP
Plasmid#61291Purposedrives luciferase from mouse IL-6 promoter with mutant C/EBP (NF-IL-6) siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseTagsExpressionMammalianMutationMutated C/EBP binding site from ACATTGTGCAATCT to…PromoterIL-6 promoter with mutant C/EBP binding siteAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U3
Plasmid#173156PurposeSingle guide RNA cassette under U3 promoterDepositorInsertsgRNA cassette under U3 promoter
UseTagsExpressionPlantMutationPromoterpromoter region of the U3C snRNA gene (Marshallsa…Available sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralTagsExpressionMutationPromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorInsertPromoter of RRT8 (RRT8 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUB-GFP
Plasmid#11155PurposeMammalian expression vector for expression of GFP (Ubiquitin C promoter)DepositorUseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdc20
Plasmid#160954PurposeCdc20 shRNA in pMKO.1 retroviral vectorDepositorInsertCdc20 shRNA (Cdc20 Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterU6Available sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA4
Plasmid#136459PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Human, Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-CA
Plasmid#20960PurposepiggyBac empty vector with Gatweway cassette and CAG constitutive promoterDepositorInsertGateway Destination Vector
UsepiggybacTagsExpressionMammalianMutationPromoterAvailable sinceMay 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-ERT2CreERT2
Plasmid#149436PurposeROSA26 targetting vector with tamoxifen-inducible Cre recombinaseDepositorInsertERT2-Cre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTAL-MajSat-FLAG-NLS-VP64
Plasmid#69074PurposeExpresses TALE for mouse major satellite with VP64 and FLAG under CAG promoterDepositorInsertTALE
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTAL-MajSat-FLAG-NLS-MCS
Plasmid#69073PurposeExpresses TALE for mouse major satellite with FLAG tag under CAG promoterDepositorInsertTALE
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-CreERT2
Plasmid#149437PurposeROSA26 targetting vector with tamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC-GoldyTALEN
Plasmid#38143Purposedestination vector for the Golden Gate TALEN kit, directs expression of TALENs from a truncated CAGs promoterDepositorInsertGoldyTALEN
UseTagsAcV5 and FokI homodimerExpressionMammalianMutationTruncate at N and C terminousPromoterminiCaggsAvailable sinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-FlpERT2
Plasmid#149438PurposeROSA26 mouse targeting vector with tamoxifen-inducible Flp recombinaseDepositorInsertFlp-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT241_(pCA-ATG-intron-tTA2)
Plasmid#36875DepositorInserttTA2
UseTagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available sinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1653_sgSOD1
Plasmid#63711PurposeExpress sgSOD1 in mammalian cells of human.DepositorInsertsgSOD1, CAG promoter, mCherry, puro
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATM (pKD-G11)
Plasmid#62690PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP123/amiR-eGFP419/tdTomato
UseRNAiTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJM597 ZF(2/6)x3 mKate2 in TUPV1
Plasmid#161531PurposeInducible expression of mKate2 under the ZF(2/6)x3 promoterDepositorInsertmKate2
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF(2/6)x3Available sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only