We narrowed to 9,991 results for: FIE
-
Plasmid#97053PurposeExpressing Sulfolobus islandicus rudivirus (SIRV) orf 131 proteinDepositorInsertSIRV orf 131
TagsN-terminal TEV protease cleavable 6xHis tagExpressionBacterialMutationnonePromoterT7Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEAHISSIRV418/gp25
Plasmid#97052PurposeExpressing Sulfolobus islandicus rudivirus (SIRV) orf 418/gp25 proteinDepositorInsertSIRV orf 418/gp25
TagsN-terminal TEV protease cleavable 6xHis tagExpressionBacterialMutationnonePromoterT7Available SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-chimeric-IgM-mouse/human_M18
Plasmid#91738PurposeExpression plasmid coding for modified heavy chain of mouse IgM antibody. Residues 203-239 (EU numbering) were exchanged to human homologue sequence.DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationResidues 203-239 (EU numbering) were exchanged to…PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-beta-1 in pcDNAI/Amp
Plasmid#55707PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta1. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal s produced.DepositorInsertmCer(1-158)-beta 1 (GNB1 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(159-238)-beta-5 in pcDNAI/Amp
Plasmid#55778PurposeA carboxyl-terminal mCerulean fragment was fused to Gbeta-5. When co-expressed with an amino terminal mCerulean fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCer(159-238)-beta-5 (GNB5 Human, Aequorea victoria)
TagsmCer(159-238) was fused to the amino terminus of …ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCag SE (Self-excising) FlpO-2A-Cre EV
Plasmid#130986Purposeepisomal expression of FlpO and Cre recombinases, self excisingDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianMutationprotamine intron added to FlpO to prevent bacteri…PromoterCMV/Chick β-actin (CAG)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
MOS
Plasmid#64120PurposeA modified episomal (EBNA1/oriP) vector expressing human OCT4 and SOX2 genesDepositorAvailable SinceOct. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTripZ RB1 WT-3XFLAG
Plasmid#209070PurposeDOX-ON inducible expression vector that expresses RB1 WT with c-terminal 3X flag tagDepositorInserthuman RB1 WT after LR recombination with pTripZ NEO DEST to inducibly express RB1 WT with a c-terminal 3X flag tag
UseLentiviralTags3XFLAGExpressionMammalianPromoterCMVAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
MMK
Plasmid#64121Purposea modified episomal (EBNA1/OriP) vector expressing human Myc and KLF4 genesDepositorAvailable SinceOct. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_mGreenLantern_FRT-PuroR-HSV-TK
Plasmid#177868PurposeCloning Backbone for mGreenLantern-based EXSISERS containing FRT-sites flanked PuroR-HSV-TK cassette; clone homology arms via BbsI (or BpiI).DepositorInsertmGreenLantern-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-gamma-2 in pcDNAI/Amp
Plasmid#55777PurposeA C-terminal CFP fragment was fused to Ggamma-2. When co-expressed with an N-terminal mCerulean, CFP, or YFP fragment fused to a Gbeta subunit with which it interacts a fluorescent signal is produced.DepositorInsertCFP(159-238)-gamma-2 (GNG2 Human, Aequorea victoria)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_ybbR_Tau MTBD
Plasmid#159719PurposeExpresses microtubule-binding domain of tau (amino acids 242-367) in Sf9 cells with a ZZ affinity tag and a ybbR tagDepositorInsertTau microtubule-binding domain only (amino acids 242-367) (MAPT Human)
TagsZZ affinity tag, ybbR tagExpressionInsectMutationOnly amino acids 242-367Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-5 in pcDNAI/Amp
Plasmid#55763PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-5. When co-expressed with an amino terminal CFP or YFP fragment fused to a Ggamma subunit or RGS7, a fluorescent signal is produced.DepositorInsertCFP(159-238)-beta-5 (GNB5 Human, Aequorea victoria)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-2 in pcDNAI/Amp
Plasmid#54472PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-2. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma -2 (GNG2 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNTK Gatad2a flox
Plasmid#110812PurposeDonor targeting vector for generating mouse Gatad2a conditional knockout alleleDepositorInsertmGataD2a (Gatad2a Mouse)
UseUnspecifiedAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-1 in pcDNAI/Amp
Plasmid#54471PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-1. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-1 (GNGT1 Aequorea victoria, Bovine)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-5 in pcDNAI/Amp
Plasmid#55625PurposeAn amino-terminal mCerulean fragment was fused to Ggamma-5. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-5 (GNG5 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-5 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-7 in pcDNAI/Amp
Plasmid#54473PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-7. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-7 (GNG7 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-1 in pcDNAI/Amp
Plasmid#55615PurposeAn amino-terminal CFP fragment was fused to Ggamma-1. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-1 (GNGT1 Aequorea victoria, Bovine)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55616PurposeAn amino-terminal CFP fragment was fused to Ggamma-2. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP (1-158)-gamma-2 (Gng2 Aequorea victoria, Mouse)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-10 in pcDNAI/Amp
Plasmid#55192PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-10. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP-(159-238)-gamma-10 (GNG10 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-12 in pcDNAI/Amp
Plasmid#55194PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-12. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-12 (GNG12 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5E itga11a-cFos
Plasmid#240524Purpose5' Gateway Entry vector containing the itga11a-cFos promoter for fibroblast-specific expression in zebrafishDepositorInsertsUseUnspecifiedAvailable SinceOct. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-RXRa-Myc; pGK-H2B-RFP
Plasmid#242887PurposeFor lentiviral overexpression of Myc-tagged human RXRa coupled to H2B-RFP (in the opposite direction)DepositorInsertRxra (RXRA Human)
UseLentiviralTagsH2B-mRFPExpressionMammalianMutationHuman RXRa cDNA was PCR-amplified from pSV-Sport-…PromoterTetracycline response element upstream of a minim…Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Human, Synthetic)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only