We narrowed to 2,920 results for: GFP reporter gene
-
Plasmid#153164PurposeTruncated mouse gamma-synuclein (mSncg-1.03kb) promoter-mediates gene expression in mammalian retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLV-PGK-dt/CBA-EGFP-NLS
Plasmid#163918PurposeContains bidirectional reporter genes dtomato and nuclear-targeting EGFP.DepositorInsertdtomato and EGFP
UseLentiviralExpressionMammalianMutationAdded nuclear localization signal to EGFPAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-Hsp-eGFP-PGK-mCherry
Plasmid#191862PurposeHeat inducible eGFP reporter with constitutive mCherry markerDepositorInsertseGFP
mCherry
UseLentiviralExpressionMammalianPromoterHSPA7 promoter and PGK promoterAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 T21R-vhhGFP4-T2A-mCherry
Plasmid#225587PurposeMammalian expression vector for TRIM21 RING-vhhGFP4 anti-GFP degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R-vhhGFP4-T2A-mCherry
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREP-8xARE-GFP-SV40-BFP
Plasmid#134910PurposeNRF2 reporter plasmid with GFP under control of 8 ARE elements and constitutively transcribed BFPDepositorInserts8xARE- minimal promoter - GFP
TagBFP
ExpressionMammalianPromoter8xARE - minimal promoter and SV40Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX304 Flag-mCherry-eEF1A1_IRES-GFP
Plasmid#198383PurposeeEF1A1 fluorescent reporterDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
phage UbiC NLS HA stdPCP stdGFP
Plasmid#104099PurposeLentiviral vector expressing synonymous tandem PP7 coat protein fused to synonymous tandem GFP. Used to label reporter mRNAs.DepositorInsertstdPCP-stdGFP
UseLentiviralTagsN-terminal NLS, Two synonymous copies of GFP (C-t…ExpressionMammalianAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRaGE Pyl TAG GFP Y35TAG
Plasmid#160041PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.DepositorInsertsPyrrolysyl tRNA synthetase (Methanosarcina mazei)
Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
deGFP
UseSynthetic BiologyTagsHis-tagExpressionBacterialMutationChanged tyrosine 35 to TAG stop-codon (Site numbe…PromoterP70b promoter and T500 terminator, Vibrio natrieg…Available SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hLMX1A-T2A-copGFP
Plasmid#170444PurposeLentiviral vector expressing human LMX1A (with silent mutation) with copGFP reporter gene, under control of EF1alpha promoter.DepositorInserthuman LMX1A
UseLentiviralPromoterEF1aAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPRKCZ-C20-EGFP (C-PRKCZ-C20)
Plasmid#217761PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationC20 domain (aa 405-592)PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-PRKCZ-C20 (N-PRKCZ-C20)
Plasmid#217762PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationLinker GGSSGGGA plus C20 domain (aa 405-592)PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB-tight-DDdCas9VPH-T2A-GFP-IRES-Neo
Plasmid#102890PurposePiggyBac construct with doxycyline inducible TRE-tight promoter expression of TMP inducible DDdCas9VP192-p65-HSF1 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-p65-HSF1-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterTRE-tightAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VPH-T2A-GFP-IRES-Neo
Plasmid#102886PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192-p65-HSF1 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-p65-HSF1-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-tight-DDdCas9VP192-T2A-GFP-IRES-Neo
Plasmid#102889PurposePiggyBac transposon system construct with doxycyline inducible TRE-tight promoter expression of TMP inducible DDdCas9VP192 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterTRE-tightAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VPP300-T2A-GFP-IRES-Neo
Plasmid#102887PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192-P300core activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-P300-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-tight-DDdCas9VPP300-T2A-GFP-IRES-Neo
Plasmid#102891PurposePiggyBac construct with doxycyline inducible TRE-tight promoter expression of TMP inducible DDdCas9VP192-P300core activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-P300-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterTRE-tightAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
IX702: pMVP (L3-L2) OLLAS-IRES-eGFP + polyA
Plasmid#121748PurposepMVP L3-L2 entry plasmid, contains OLLAS epitope tag + IRES2-eGFP + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion and IRES expression of eGFP reporterDepositorInsertOLLAS epitope tag-IRES2-eGFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.KRAB-mArid3a.IRES.GFP
Plasmid#169306PurposeConstitutive overexpression of murine KRAB-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.VP64-mArid3a.IRES.GFP
Plasmid#169313PurposeConstitutive overexpression of murine VP64-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-CoV2-Inframe-stop
Plasmid#177620PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. GFP is in-frame with mCherry. Thus GFP translation is prevented by stop codon within FSE (negative control).DepositorInsertSARS-CoV-2 FSE
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-KSR1-CA3 (N-KSR)
Plasmid#217755PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKSR1-CA3-GS-EGFP (C-KSR-GS)
Plasmid#217757PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDest-1.7kbfabp6-eGFP-pA-CrymCherry
Plasmid#159088PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA insertsDepositorInsertsUseFluorescent reporterPromoter1.7kb fabp6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-THRA-RFP-EGFP
Plasmid#228537PurposeBichromatic fluorescent reporter of THRA isoform 1 and isoform 2 splicing in mammalian cellsDepositorInsertThyroid Hormone Receptor Alpha (THRA Human)
TagseGFP and tagRFPExpressionMammalianPromoterCMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-nAChr-Alpha6-GFP
Plasmid#50486Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChr-alpha6 (Chrna6 Mouse)
TagsGFP fusion in M3-M4 loop (after residue A405)ExpressionMammalianMutationGly-Ala-Gly flexible linker flanking the GFP open…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA E45A
Plasmid#217438PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with E45A mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA E45AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA M66I
Plasmid#217440PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with M66I mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA M66IAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ Lox 5'UTR
Plasmid#67932PurposeTranslational reporter - Lox 5'UTRDepositorAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
LSM075 SFFV-mCherry-SGc(stem-1(3xMS2)x2)cSG-EGFP (FLP-IN)
Plasmid#233439PurposeSFFV driven LIDAR reporter with 2 tandem substrate stem loopsDepositorInsertmCherry-SGc(stem-1(3xMS2)x2)cSG-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMS-dsRed2-C1824U LMNA-GFP minigene
Plasmid#128231PurposeC1824U mutation Lamin A splicing reporterDepositorInsertlamin A (LMNA Human)
TagsGFP and SV40-driven dsRed2 to identify transfecte…ExpressionMammalianMutationC1824UPromoterCMVAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-GFP-WPRE-miR124T
Plasmid#245069PurposeFluorescent reporter gene with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertEGFP, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-K0-P2A-mCherry
Plasmid#185619PurposeRibosomal stalling reporter: emptyDepositorInsertGFP-empty-mCherry
ExpressionMammalianPromoterCMVAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286D/T305A/T306A)
Plasmid#127392PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286D/T305A/T306A)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to Aspartic acid and Threon…PromoterpCAGAvailable SinceJuly 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B G120A
Plasmid#123235PurposeExpresses mCherry-EGFP-LC3B G120A in mammalian cells. Negative control for tandem reporter. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-PSD95-EGFP-WPRE
Plasmid#133785PurposeCre-dependent EGFP Fluorescent reporter for overexpressed postsynaptic marker PSD95 in mammalian cellDepositorAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcs2-MTS-cox8A-GFP-IRES-mCherry
Plasmid#226103PurposeStability reporter construct of the COX8A mitochondrial targeting sequence (MTS) for transient expression in mammalian cellsDepositorInsertCOX8A (COX8A Human)
TagsGFPExpressionMammalianMutationencodes only for mitochondrial targeting sequence…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only