We narrowed to 4,733 results for: Gca
-
Plasmid#103141PurposeTriple gRNA expression separated with 28nt Csy4 motifDepositorInsertgRNAs
ExpressionYeastAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-Decoy
Plasmid#80324PurposeEncodes Cas9 and a CRISPR sgRNA that alleviates toxicity to Cas9 in Toxoplasma gondiiDepositorInsertDecoy sgRNA
UseCRISPRPromoterU6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiCHATe27_GCaMP6f (AAV1)
Viral Prep#213833-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiCHATe27_GCaMP6f (#213833). In addition to the viral particles, you will also receive purified pAAV_BiCHATe27_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the cholinergic neuron-targeting enhancer E27. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_jGCaMP8m (AAV1)
Viral Prep#213918-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiLAMP5e3_jGCaMP8m (#213918). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_jGCaMP8m plasmid DNA. Expression of jGCaMP8m under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_GCaMP6f (AAV1)
Viral Prep#213917-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiLAMP5e3_GCaMP6f (#213917). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Nkx2-1*/Neo
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pENTR APP shRNA 1
Plasmid#30134DepositorInsertAPP shRNA 1
ExpressionMammalianAvailable SinceJuly 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
7h sgRNA for 4-μHOM reporter
Plasmid#113625PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter at the edge of the microhomology.DepositorInsert7h sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-B
Plasmid#177812PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe4_GCaMP6f (AAV PHP.eB)
Viral Prep#213947-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiSSTe4_GCaMP6f (#213947). In addition to the viral particles, you will also receive purified pAAV_BiSSTe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the SST interneuron-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro-C145A-Q306A
Plasmid#177335Purposebacterial expression of inactive SARS-CoV-2 3C-like-C145A proteinaseDepositorInsertSARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shSOD1
Plasmid#102975PurposeSuppression of SOD1DepositorInsertshSOD1 (SOD1 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-A
Plasmid#177784PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-GFP>BFP_Y66H-NGG
Plasmid#185480PurposepegRNA plasmid in order to make a Y66H (TAC>CAT) conversion in the GFP gene, creating a BFP gene.DepositorInsertGFP>BFP_Y66H-pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-GEMSgRNA2
Plasmid#204768PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.DepositorInsertguide RNA targeting GEMS m6A sensor mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUDE735
Plasmid#103024Purposeexpression of a Cpf1 programming crRNA targetting CAN1, HIS4, PDR12 and ADE2 (crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S)DepositorInsertcrCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
UseCRISPRExpressionYeastPromoterSNR52Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR5
Plasmid#213053PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR5DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_ASCL1
Plasmid#64130PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pX-EGFP-g1
Plasmid#107273PurposeeGFP sgRNA-1 and Cas9 expression vector (aka. pX-ps1)DepositorInsertGFP sgRNA-1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA1.1
Plasmid#64116PurposeVector for expression of St1 sgRNA1.1 in mammalian cellsDepositorInsertSt1 sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only