We narrowed to 17,856 results for: por
-
Plasmid#197092PurposePiggyBac plasmid with tet-inducible expression of transcription factors for sensory neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pDONR221-Basigin_iso2
Plasmid#221416PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertBasigin_iso2 (BSG Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLEX-PGK-LAMP1-HaloTag
Plasmid#164216PurposepLEX lentivirus backbone expresses HaloTag tagged LAMP1 under PGK promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Basigin
Plasmid#221415PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertBasigin (BSG Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Embigin
Plasmid#221417PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertEmbigin (EMB Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 WT
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKT2/CAGXSP/CD63mScarlet
Plasmid#182972PurposeStably express CD63 fused with mScarlet in mammalian cells via the sleeping beauty transposon system.DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AKAP1-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170995PurposeHiLITR transcription factor with AKAP1 N-terminal tmd targeting sequence (mitochondria)DepositorInsertAKAP1(tmd)-NNES-hLOV-TEVcs(ENLYFQ/M)-GAL4bd-VP64-V5 (AKAP1 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE-K2N
Plasmid#154879PurposeEpisomally expresses KLF2 and NANOG in mammalian cellsDepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE-KdGl
Plasmid#154880PurposeEpisomally expresses KDM4D and GLIS1 in mammalian cellsDepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDR-FOXL2-T2A-tdTomato-PuroTK
Plasmid#192892PurposeHDR donor for inserting FOXL2-T2A-tdTomato reporterDepositorInsertFOXL2-tdTomato (FOXL2 Human)
UseCRISPRMutationT2A-tdTomato fluorescent reporterPromoterPGKAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR1c-V5/HIS
Plasmid#201106Purposeexpression of human FGFR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR1 receptor tyrosine kinase, variant c, full length, wildtype (FGFR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
OMM-short-RspA-CFAST
Plasmid#233594PurposeExpression of RspA-CFAST on the outer mitochondrial membraneDepositorInsertTOM70 fragment-RspA-CFAST (TOMM70 RspA-CFAST from Rheinheimera sp A13L and TOM70 fragment from Homo sapiens, Human)
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC4A11_STOP
Plasmid#161358PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC4A11 (SLC4A11 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMIH-TFAM-GFP
Plasmid#113704PurposeFluorescent fusion protein used to visualise mitochondrial nucleoids, with hygromycin selectionDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-{CMV-CuO}>{PAX3::FOXO1}:T2A:mCherry
Plasmid#236629PurposePuromycin selected lentiviral construct with cumate-inducible PAX3::FOXO1DepositorUseLentiviralExpressionMammalianPromoterCMV-CuOAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC4A4_STOP
Plasmid#161426PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC4A4 (SLC4A4 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
EF1a-mEmerald-CAPRIN1
Plasmid#164218PurposeExpresses mEmerald tagged CAPRIN1 under EF-1a promoterDepositorAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX-EF1a ANXA11-mEmerald
Plasmid#164210PurposepLEX lentivirus backbone expresses mEmerald tagged ANXA11 under EF1a promoterDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZ:F3-CAGGS GPHTK-F
Plasmid#112666PurposeGenome engineering donor vector for creating master cell lines suitable for FLPe recombinase-mediated cassette exchange (RMCE) in the AAVS1 locusDepositorInserteGFP
UseGene targeting vector for integration at the s1 s…ExpressionMammalianPromoterCAGAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBAC-ie1-DsRed-ObirOrco-QF2-15xQUAS-GCaMP6s
Plasmid#200400PurposeExpresses DsRed broadly, expresses QF2 and GCaMP6s in OSNs of the clonal raider antDepositorInsertsDiscosoma red fluorescent protein
Q factor 2
GCaMP6s
ExpressionInsectPromoter15x QUAS, ObirOrco (Oocearaea biroi Orco promoter…Available SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC39A7_STOP
Plasmid#161331PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC39A7 (SLC39A7 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
TagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC52A3
Plasmid#132181PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC52A3 (C20orf54 Human)
ExpressionMammalianAvailable SinceOct. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
MSCV-AML1/ETO-IRES-GFP
Plasmid#60832PurposeAML1/ETO9a cDNA was generated by PCR from full-length human AML1/ETO-IRES-GFP and subcloned into MSCV-IRES-GFPDepositorAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GCaMP5G
Plasmid#31788Purposea single-wavelength GCaMP3-based calcium indicator with improved response. Please also see the GCaMP6s/m/f indicators.DepositorInsertGCaMP5G
Tags6xHis, T7 epitope, and Xpress tagExpressionMammalianPromoterCMVAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC3A2_STOP
Plasmid#161379PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC3A2 (SLC3A2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC35F6
Plasmid#132073PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35F6 (C2orf18 Human)
ExpressionMammalianAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits