We narrowed to 10,418 results for: 158
-
Plasmid#194555PurposeMammalian Expression of mEGFP-HMGB1 WT Fusion Protein, "del FS" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationtruncation by stop codon after Lys183PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-Rdel
Plasmid#194556PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R del" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationDeletion of Arginines after Lys185PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RorKtoA
Plasmid#194558PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R or K > A" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationR or K > A substitutions after Lys185PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-DVL1-MUT
Plasmid#194587PurposeMammalian Expression of mEGFP-DVL1 Mutant (H502Pfs*143) Fusion ProteinDepositorInsertDVL1 (DVL1 Human)
UseTagsmEGFPExpressionMammalianMutationH502Pfs*143PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RtoA
Plasmid#194557PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R > A" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationR > A substitutions after Lys185PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT1093 human L1 EN- (ORF2p E43S, D145N) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213028PurposeExpresses endonuclease dead (EN- ORF2p E43S, D145N) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, EN- E43S D145N) with ORF2-3xFlag
UseTags3xFlag (ORF2p)ExpressionMammalianMutationE43S D145N double mutant EN- endonuclease catalyt…PromoterCMVAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT870 human L1 RT- (ORF2p D702Y) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213027PurposeExpresses reverse transcriptase dead (RT- ORF2p D702Y) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, RT- D702Y) with ORF2-3xFlag
UseTags3xFlag (ORF2p)ExpressionMammalianMutationD702Y (RT- reverse transcriptase catalytic dead)PromoterCMVAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT647 human L1 ORF2p-3xFlag only (ORFeus-Hs, CMV promoter, monocistronic construct) in pCEP4 Puro (derivative of pMT646)
Plasmid#213029PurposeExpresses human LINE-1 ORF2 only in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 ORF2p only (monocistronic, codon optimized ORFeus-Hs sequence) with ORF2-3xFlag
UseTags3xFlagExpressionMammalianMutationPromoterCMVAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a G1202R
Plasmid#183830PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) harboring ALK G1202R mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianMutationG1202RPromoterCMVAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a L1196M/G1202R
Plasmid#183831PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) harboring ALK L1196M/G1202R mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianMutationL1196M/G1202RPromoterCMVAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSrTA1662-toolkit
Plasmid#154372PurposeExpresses SrTA1662 in plantsDepositorInsertSrTA1662
UseTagsExpressionBacterial and PlantMutationPromoterNative promoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Humagne Set C
Pooled Library#172650PurposeSet C contains best-ranked guides 1 and 4.DepositorExpressionMammalianAvailable sinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Humagne Set D
Pooled Library#172651PurposeSet D contains best-ranked guides 2 and 3.DepositorExpressionMammalianAvailable sinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mouse sphingolipid metabolism knockout library
Pooled Library#206249PurposeThe sphingolipid metabolism library targets 82 mouse genes in the de novo ceramide and downstream sphingolipid metabolism pathways.DepositorUseCRISPR and LentiviralAvailable sinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Mouse lipid metabolism knockout library
Pooled Library#206248PurposeThe lipid metabolism library contains guide RNAs against 295 genes targeting mouse genes encoding enzymes that directly impact lipid metabolism.DepositorUseCRISPR and LentiviralAvailable sinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
BARBEKO sgRNA library
Pooled Library#174163PurposeiBARed cytosine Base Editing-mediated gene KnockOut (BARBEKO) sgRNA library; This library leverages CRISPR cytosine base editors for genome-scale knockout screens.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
ACER
Pooled Library#226117PurposeThe Advanced Catalogue of Epigenetic Regulators (ACER) library allows scientists to study how different epigenetic proteins influence gene activity and contribute to diseases.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Compact mismatched sgRNA library for gene titration (human essential genes, CRISPRi)
Pooled Library#136479PurposeExpresses gRNAs for gene titration of ~2400 human genes using CRISPRiDepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Large-scale mismatched sgRNA library for gene titration (human essential genes, CRISPRi)
Pooled Library#136478PurposeExpresses gRNAs for gene titration of ~2400 human genes using CRISPRiDepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human Base Editing Sensor Library
Pooled Library#179218PurposesgRNAs that target frequently occurring cancer associated mutations identified in the MSK IMPACT dataset that can be modeled with cytosine base editing.DepositorExpressionMammalianUseLentiviralAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Mouse Base Editing Sensor Library
Pooled Library#179217PurposesgRNAs that target frequently occurring cancer associated mutations identified in the MSK IMPACT dataset that can be modeled with cytosine base editing.DepositorExpressionMammalianUseLentiviralAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
ALL-PAM sensor Library
Pooled Library#179219Purpose10 human and mouse sgRNAs each where for each sgRNA the tethered target site has 1 of 64 possible 3 bp PAM sequences.DepositorExpressionMammalianUseLentiviralAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Target Accelerator Pan-Cancer Mutant Collection
Plasmid Kit#1000000103PurposePanel of cancer alleles that have undergone basic, functional screening; full-length, human clones (454 mutant and 177 corresponding wild-type) in the Gateway cloning systemDepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro
Plasmid#141395PurposeLentiviral expression of SARS-CoV-2 protein; transient expression and generate lentivirusDepositorInserteGFP
UseLentiviralTags2xStrepExpressionMammalianMutationhuman codon optimizedPromoterEF1alphaAvailable sinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro
Plasmid#141385PurposeLentiviral expression of SARS-CoV-2 envelope (E) protein; transient expression and generate lentivirusDepositorInsertSARS-CoV-2-E (E SARS-CoV-2)
UseLentiviralTags2xStrepExpressionMammalianMutationhuman codon optimizedPromoterEF1alphaAvailable sinceApril 8, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro
Plasmid#141391PurposeLentiviral expression of SARS-CoV-2 nucleocapsid (N) protein; transient expression and generate lentivirusDepositorInsertSARS-CoV-2-N (N SARS-CoV-2)
UseLentiviralTags2xStrepExpressionMammalianMutationhuman codon optimizedPromoterEF1alphaAvailable sinceApril 8, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro
Plasmid#141386PurposeLentiviral expression of SARS-CoV-2 membrane (M) protein; transient expression and generate lentivirusDepositorInsertSARS-CoV-2-M (M SARS-CoV-2)
UseLentiviralTags2xStrepExpressionMammalianMutationhuman codon optimizedPromoterEF1alphaAvailable sinceApril 8, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits