We narrowed to 13,244 results for: BASE;
-
Plasmid#120173PurposeExpresses a chimera of the mitochondria-targeting signal of TOM20, SBP tag and GFP (fluorescent tag)DepositorInsertMitochondrial import receptor subunit TOM20 homolog (TOMM20 Human)
TagsSBP and eGFPExpressionMammalianMutationTruncated TOM20: 1-30 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi2-LgB91
Plasmid#134358PurposeNanoluc complementation assay. Expression of Gαi2 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi2. Addition of the HA epitope at N terminus of Gαi2.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpCas9-NG-P2A-EGFP (RTW4564)
Plasmid#140005PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9-NG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-dMSK1
Plasmid#165602PurposeExpresses Sp dCas9 fused to truncated human MSK1 (42-802)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated human Mitogen- and stress-activated protein kinase-1 (42-802) (RPS6KA5 Human, Synthetic, S. Pyogenes)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:TV:Tnos (GB2047)
Plasmid#160626PurposeTU for the constitutive expression of dCas9 fused to TV (TALx6 - VP128) activation domainsDepositorInsertP35s-dCas9:TV-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v8-10 (fl)
Plasmid#137823Purposeexpression of CD44 proteins in mammalian cellsDepositorAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-15
Plasmid#228971PurposeFor bacterial expression of anti-GFP nanobody LaG94-15, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-15
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pafG-CBE-3T
Plasmid#220374Purposefor hA3A-nCas9 and gRNA expression in Aspergillus flavusDepositorInsertshA3A-nCas9
tRNA and gRNA scaffold
UseCRISPRPromoterPtef1 and tRNAAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v2-10 (fl)
Plasmid#137824Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (fl) (CD44 Human)
TagsGFPExpressionMammalianMutationfull length and mutations A282T, T483A, N535D, S5…PromoterPGKAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
Tags6xHis Tag and TEV Cleavage SiteExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2a KI
Plasmid#131486PurposeEndogenous tagging of GluN2a: N-terminal (amino acid position: A25)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGLOW79
Plasmid#177339PurposeC. elegans mNeonGreen co-injection markerDepositorInsertPmyo-3::mNeonGreen
TagsmNeonGreenExpressionWormPromotermyo-3Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti NL
Plasmid#113450PurposeLentiviral NanoLuc control expression vectorDepositorInsertNanoLuc
UseLentiviral and LuciferaseTagscmycExpressionMammalianPromoterhUbCAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 Human, Synthetic, S. Pyogenes)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-B-GRAM-W-NeoR
Plasmid#211710PurposeLentiviral expression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187W mutation (B-GRAM-W)DepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-8
Plasmid#228990PurposeFor bacterial expression of anti-GST nanobody GST-8, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-8
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only