We narrowed to 19,878 results for: INO
-
Plasmid#111849PurposeExpresses wild type human KRAS (amino acids 1 - 169) in E. coli with amino terminal 6xHIS tag that can be removed with TEV protease.DepositorInsertKRAS (KRAS Human)
Tags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialPromoterT5Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6F
Plasmid#137123PurposeIntersectional viral expression of GCaMP6F in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs T3950D
Plasmid#83320PurposeDNA-PKcs T3950ADepositorInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutationActivation loop phosphorylation site 3950 substit…Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX_314-HRI-V5
Plasmid#202434PurposeExpression of HRIDepositorAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET
Plasmid#193364Purposeexpression of human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX2-tTA2-WPRE-bGHpA
Plasmid#65458PurposeCan be used to generate AAV virus that will express the tetracycline transactivator tTA2 from the CAG promoter in a Cre-dependent mannerDepositorInserttTA2
UseAAVPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB53x EF1-Dendra2-RPB1Amr
Plasmid#81228Purposeexpresses Dendra2-Rpb1 fusion in mammalian cells. Possible to insert into the genome using the Piggibac systemDepositorInsertDendra2 - Rpb1 (alpha amanitin resistant) (POLR2A Human)
TagsDendra2ExpressionMammalianMutationN792D alpha amanitin resistance mutation (Bartolo…PromoterEF1aAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-kz-CD20-Puro
Plasmid#209759PurposeLentiviral transfer plasmid to express the CDS of the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AMBRA1-3xFLAG
Plasmid#172605PurposeExpresses 3xFLAG-tagged AMBRA1 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SpRFN
Plasmid#85754PurposeExpresses S. pyogenes FokI-dCas9-NLS with a 25 amino acid linker (GGGGS)5 fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Derived from pSQT1601 (Addgene #53369).DepositorInsertCsy4-T2A-FokI-dCas9
UseCRISPRTagsCsy4 and FokI fusion via 25 amino acid (GGGGS)5 l…ExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP
Plasmid#137140PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK297 (DHC1-mAID Hygro)
Plasmid#140542PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-hRPH3A_c.444Gwt
Plasmid#190476Purposeminigene assayDepositorInsertRPH3A (NM_014954.3) c.444 [exon 7 and part of surrounding introns only] (RPH3A Human)
ExpressionMammalianPromoterSV40Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMK296 (DHC1-mAID Neo)
Plasmid#140541PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CDK2
Plasmid#172616PurposeExpresses 2xFLAG-2xSTREP-tagged CDK2 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-SFFV-GLuc-CreERT2-mCherry
Plasmid#178185Purposethe plasmid promotes the constitutive expression of CreERT2 to enable intracellular recombination, Gaussia Luc can be used for in vivo imaging and mCherry is used as a marker for ex vivo analyses.DepositorInsertsGLuc
CreERT2
mCherry
UseLentiviralAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29 (JO582)
Plasmid#208954PurposeA variant CE1 construct with Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), Phi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-EIN-FTO(32-505)
Plasmid#186466PurposeExpresses human RNA demythelase protein FTO 32-505 amino acid sequence with N-terminal fusion with the N-domain of EI ( e.coli protein)DepositorInsertFat mass obesity associated protein (FTO Human)
Tags6 Histidine-EIN (N-terminal domain of E.coli Enzy…ExpressionBacterialMutationamino acid 32-505PromoterT7Available SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only