169,450 results
-
Plasmid#105669PurposeExpresses a soma-targeted GtACR2 in mammalian neurons under the CaMKIIa promoterDepositorHas ServiceAAV Retrograde and AAV1InsertstGtACR2
UseAAVTagsFusionRed and Kv2.1ExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCM-CLYBL-hNIL
Plasmid#105841PurposeDonor construct for introduction of hNIL factors to CLYBL safe harbor site and iPSC differentiation to motor neuronDepositorInsertsUseCRISPR and TALENPromoterCAG, EF-1alpha, and TRE3GAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-RFP entry
Plasmid#192278PurposeEntry vector for cloning MmCas12m spacers. RFP flanked by MmCas12m CRISPR repeats can be digested out with BbsI.DepositorInsertRFP flanked by type V-M CRISPR repeat sequences
UseCRISPRExpressionBacterialPromoterPJ23119Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B Q78L
Plasmid#89448PurposeExpression of GFP-tagged human Rab27B Q78L in mammalian cellsDepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-TurboID-V5-CDK13_IDG-K
Plasmid#135267PurposeGateway destination clone of CDK13 (human) tagged with N-terminal TurboID-V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertTurboID-V5-CDK13 (CDK13 Human)
UseLentiviral; Gateway destinationTagsV5-TurboIDExpressionMammalianPromoterUbiquitinAvailable SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRL-TK CXCR4 2x
Plasmid#11306DepositorInsert2 bulged bind sites for CXCR4 siRNA antisense
UseLuciferaseTagsRr-lucAvailable SinceFeb. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pETM6-E12-vioABECD
Plasmid#66537PurposepETM6 vector containing vioA-vioB-vioE-vioC-vioD in monocistronic configuration with optimized promoters (E12)DepositorInsertsVioA
VioB
VioE
VioC
VioD
UseSynthetic BiologyExpressionBacterialPromoterMutant T7 Promoter - G6 and Mutant T7 Promoter - …Available SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP (AAV9)
Viral Prep#117382-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified pAAV-hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCold TDP43 WT
Plasmid#27451DepositorAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGGD001
Plasmid#48833PurposeProvides linker:GFP as GreenGate C-terminal tag module.DepositorInsertLinker:GFP
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PTRE-tight-flex-hM3Dq-mCherry-WPRE-pA
Plasmid#115161PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The hM3Dq receptor expression requires both neural activity and Cre recombinase.DepositorInsertsPTRE - tet activator responsive promoter
flex sequence
hM3dq-mCherry (inverted)
flex sequence
UseAAVTagshM3Dq-mCherryExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHLUM
Plasmid#40276DepositorExpressionYeastPromoterendogenous LEU2, endogenous MET15/17, and endogen…Available SinceNov. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_3xFLAG_SUMO_Eu1_HsAGO2
Plasmid#231372PurposeExpress human AGO2 with N-terminal 3xFLAG-SUMO_Eu1 tag in mammalian cellsDepositorInsertHuman Argonaute2 (AGO2 Synthetic, Human)
Tags3xFLAG-SUMO_Eu1ExpressionMammalianPromoterCMVAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
piRFP670-N1
Plasmid#45457DepositorHas ServiceCloning Grade DNAInsertiRFP670
ExpressionMammalianMutationT2A, S45T, V116I, D124E, M170L, K180M, D202L, I20…PromoterCMVAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pExp-NusA
Plasmid#112571PurposeUsed for expression of protein in E. coli as TEV cleavable N-terminual 8His and NusA fusions with optional C-terminal StrepII-tagDepositorTypeEmpty backboneTags8His and Strep tagExpressionBacterialAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCap-101-Apr
Plasmid#227507PurposeCapture plasmid with apramycin resistance and pIJ101 repliconDepositorTypeEmpty backboneAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEB1-mCerulean
Plasmid#103968PurposePlasmid encoding mCeruleanDepositorInsertmCerulean
UseLow copyExpressionBacterialMutationMutations relative to wild-type GFP (F64L, S65T, …PromoterProCAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA
Plasmid#154867PurposeFlp-dependent hM4D(Gi) DREADD-mCherryDepositorHas ServiceAAV Retrograde and AAV8InserthM4D(Gi)-mCherry
UseAAV; Flp-frtTagsmCherryExpressionMammalianPromoterHuman Synapsin-1Available SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
MutaT7
Bacterial Strain#156460PurposeAn E. coli strain that expresses MutaT7 for mutagenizing genes downstream from a T7 promoter.DepositorBacterial ResistanceStreptomycinSpeciesRattus norvegicusAvailable SinceOct. 19, 2020AvailabilityAcademic Institutions and Nonprofits only