We narrowed to 21,844 results for: SPR
-
Plasmid#71278PurposeExpresses myc::TEV::mTagGFP::TEV::3Xflag in bacteriaDepositorInserttagGFP
TagsTEV::3xFlag and myc::TEVExpressionBacterialAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330_sgACTA2
Plasmid#63712PurposeExpress sgACTA2 in mammalian cells.DepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330-TSC1
Plasmid#254275PurposeKnockout TSC1DepositorInsertTsc1 gRNA (Tsc1 Mouse)
UseCRISPRAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MMLVgag-D3A-3L-dCas9-KOX1
Plasmid#240532PurposeExpresses MMLVgag–DNMT3A-3L-dCas9-KOX1 for producing RENDER-DNMT3A-3L-dCas9-KOX1DepositorInsertMMLVgag-D3A-3L-dCas9-KOX1
TagsFLAG, HAExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2641
Plasmid#229525PurposeCarries OsTIR1-t2a-mNG-AID*, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
UseCRISPRTagst2a-mNeonGreen-AID*ExpressionBacterial and YeastMutationF74GPromoterTEF1Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
p160Tol2-her4.3:switchCas9
Plasmid#227680PurposeExpression of cre inducible and her4.3 (Notch) dependent Cas9-GFP and U6-driven 4 sgRNAs for SABER-seq in zebrafishDepositorInsertsloxP-dsRed-loxP-Cas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterU6 and her4.3Available SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-N-mCherryTag
Plasmid#218186PurposeTo tag Hevin with mCherry at the N-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA LINE1
Plasmid#223699PurposegRNA of dPspCas13b-FTO targeting LINE1DepositorInsertgRNA target sequence for LINE1
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS84 (U6p::GGACAGTCCTGCCGAGGTGG)
Plasmid#193852PurposeEncodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGGDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
tracrRNA(scr)-CJ8421_04975 mRNA
Plasmid#199718PurposeExpresses the Campylobacter mRNA CJ8421_04975 and tracrRNA with scrambled anti-repeat sequencesequenceDepositorInsertCJ8421_04975 mRNA and scrambled tracrRNA
UseCRISPRExpressionBacterialAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F2
Plasmid#184164PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 2, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-POLI-ST2-com vector
Plasmid#176234PurposeVector plasmid for expressing spCas9-POLI fusion protein and sgRNA. There are two copies of HBB 3’ UTR in the 3’UTR of spCas9-POLI to enhance expression. The ST2 loop of the sgRNA scaffold was replaceDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcCAST-sgRNA_entry (CJT83)
Plasmid#181785PurposeExpresses AcCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
ExpressionBacterialPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OK+9MS-Cas9
Plasmid#120354PurposepiggyBac transposon for dox-inducible expression of the OK+9MS (Oct4, Klf4[1-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). SpCas9 is constitutively expressed.DepositorInsertOK+9MS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [1-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
TR- ATG-HP-GFP
Plasmid#80592PurposeExpresses GFP with an Csy4 target hairpin inserted immediately following the start codon for Csy4-mediated regulation. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.DepositorInsertGFP
UseAAVExpressionMammalianMutationInserted 30 nt hairpin which is targeted by Csy4 …PromoterCBAAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMK388 (mClover-BSD)
Plasmid#121189PurposeC-terminal taggingDepositorInsertmClover-BSD
UseCRISPRAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -