We narrowed to 25,809 results for: Spr
-
Plasmid#121540PurposeExpresses a 6X-His tagged type II-C Cas9 from H. parainfluenzae in bacterial cellsDepositorInsertHpaCas9
ExpressionBacterialAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAcrF2
Plasmid#89234PurposePlasmid contains the gene for anti-CRISPR protein AcrF2 (gene 30 from bacteriophage D3112), with N-terminal 6his tag and TEV protease cleavage siteDepositorInsertAcrF2
Tags6xHis-TEVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
G1397 DddAtox-N–SaKKH-Cas9(D10A)
Plasmid#157839Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertG1397 DddAtox-N–SaKKH-Cas9(D10A)–UGI–SV40 NLS
ExpressionMammalianAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS1027-pMCSG7-SmuCas9
Plasmid#121541PurposeExpresses a 6X-His tagged type II-C Cas9 from S. muelleri in bacterial cellsDepositorInsertSmuCas9
ExpressionBacterialAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.1
Plasmid#78536PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKS7107
Plasmid#89051PurposeExpresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9DepositorInsertsNm crRNA
Nm tracrRNA
hNmCas9
UseCRISPRTagsHA tag, NLS, and SV40 NLSPromoterEF1a and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPPC001
Plasmid#171138PurposeFor integration of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T methodDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _HITI donor B6
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3039(XII-2 MarkerFree)
Plasmid#73279PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XII-2 (Chr XII: 808805..809939)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-rac2-guides
Plasmid#168241Purpose"neutrophil specific GFP with ubiquitous rac2 sgRNAs"DepositorInsertrac2 sgRNAs
UseCRISPRAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp63-Exon4-1sgRNA
Plasmid#88848PurposeCRISPR KO of Trp63DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_CEBPG
Plasmid#86285PurposeDonor vector for 3' FLAG tag of human CEBPGDepositorAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSHS325 - Bacterial expression plasmid for SpCas9 REC3 domain
Plasmid#101205PurposeBacterial expression plasmid for SpCas9 REC3 domainDepositorInsertSpCas9 variant K506–Q712
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK506–Q712PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_GATAD2A
Plasmid#86279PurposeDonor vector for 3' FLAG tag of human GATAD2ADepositorAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS3
Plasmid#140626PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS3. The crRNA-IS3 targets IS3 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS3
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS24: pCascade(PmcCAST)_entry
Plasmid#168157PurposeInducible expression of PmcCAST Cascade proteins. Two BsaI sites for spacer cloning.DepositorInsertsPmcCAST minimal CRISPR array
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only