We narrowed to 24,091 results for: crispr
-
Plasmid#214880PurposeLentiviral vector encoding RfxCas13d targeting CD46 guideDepositorInserthU6-crCD46-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_936
Plasmid#216094PurposeCas12a [EnAs] knockout targeting CD46, CD47, CD55, CD81, positive controlDepositorInsertCD46, CD47, CD55, CD81 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -0
Plasmid#180010PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc LbaCas12a
Plasmid#182125PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc LbaCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7820 pHR (hU6-crPURI-EFS-PuroR-WPRE)
Plasmid#214883PurposeLentiviral vector encoding RfxCas13d targeting PURI guide arrayDepositorInserthU6-crPURI-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
Plasmid#214884PurposeLentiviral vector encoding RfxCas13d targeting GLY guide arrayDepositorInserthU6-crGLY-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pNOC_hfnCas12a_Nlux_(-HH)crRNA NR1
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-VRQR (pBM1173)
Plasmid#140255PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInsertBE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-RAB7A
Plasmid#227298PurposeDonor template for mStayGold insertion into the N-terminus of the RAB7A locus. For endosome visualization. To be co-transfected with sgRNA plasmid px330-RAB7A (Addgene #227297)DepositorInsertRAB7A Homology Arms flanking a mStayGold Tag (RAB7A Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE4497
Plasmid#80339Purposemammalian expression FnCpf1 nuclease and Fn crRNADepositorInsertsFn crRNA
FnCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
AA331
Plasmid#215954PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v1; trRNA_v2 [Sa]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -1
Plasmid#180011PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only