We narrowed to 29,096 results for: CAL;
-
Plasmid#51560PurposeGene encoding E. coli RNaseIII cloned as a N terminal translational fussion with superfolder GFP. Expression driven by arabinose (backbone is pBAD24).DepositorInsertrnc (rnc E. coli)
TagsGLESTCRHASLAVLADERRFSA and superfolder GFPExpressionBacterialMutationContains additonal aa at the end of the sfGFP in …Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-RiboL1-jGCaMP7c
Plasmid#192619PurposeAAV transfer plasmid for neuronal expression of soma-targeted (RiboL1) jGCaMP7c.DepositorInsertRiboL1-jGCaMP7c
UseAAVTags6xHisExpressionMammalianAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-PAK2 wt
Plasmid#31671DepositorAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
C1-MPAct(delta1-6)-mRuby3
Plasmid#155223PurposeF-actin bidning mutant of MPActDepositorInsertMutated version of F-tractin (aa 15-52 of rat ITPKA) fused to mRuby3 C-term tagged with the CaaX sequence derived from Kras4b
TagsmRuby3ExpressionMammalianMutationDeletion of first 6 AA from F-tractin (9-14 from …Available SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTn7·X-nia
Plasmid#122592PurposePlasmid for genomic integraction of xylS-Pm->nia into the Tn7 insertion siteDepositorInsertxylS/Pm->Nia
UseSynthetic Biology; Tn7 genomic integrationExpressionBacterialPromoterPmAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-axon-GCaMP6m
Plasmid#111261PurposeFor enriched expression of GCaMP6m in axonsDepositorHas ServiceAAV9Insertaxon-GCaMP6m
UseAAVTagsGAP43 palmitoylation domainExpressionMammalianPromoterhSynapsin1Available SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
aav-SYN-tdNfsB(F124W)-mCherry (eNTR)
Plasmid#113760PurposeAAV-mediated expression of bacterial tdNfsB-mCherry (eNTR) under the SYN promoterDepositorInserttdNfsB(F124W)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationF124WPromoterSynapsinAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
actc1b-mKate2-ING2
Plasmid#109502PurposeMuscle specific zebrafish expression of mKate2 fused to 3xPHD domain from Mouse inhibitor of growth family member 2 (ING2), codon optimised. Binds PtdIns5PDepositorInsertactc1b-mKate2-ING2
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1-FGB (FlincG2)
Plasmid#49204PurposeFluorescent reporter for cGMPDepositorAvailable SinceMay 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-PGAL1-GFP
Plasmid#41614DepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Available SinceDec. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET303-ColE1-T-E192C
Plasmid#180233PurposeExpresses T domain of Colicin E1 (residues 1-190) with C terminal cysteine for maleimide chemistryDepositorInsertColicin E1
Tags6x His-tagExpressionBacterialMutationTruncation of ColE1 containing T domains (residue…PromoterT7Available SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS306-pHIS3-2xGFP-tURA3
Plasmid#116936PurposeYeast integrative vector for the expression of 2xGFPDepositorInsert2xGFP
ExpressionYeastPromoterHIS3Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
anxA9-GFP
Plasmid#107198PurposeExpresses human annexin A9-GFP fusion protein for live cell imagingDepositorAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-GST-RNMT
Plasmid#112709PurposeExpresses N-terminally GST-tagged human RNMT in bacterial cellsDepositorAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-EGFP-RAMP4-IRES-Puromycin
Plasmid#134863PurposeExpresses EGFP-tagged endoplasmic reticulum markerDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
nTRb412-gs10-NLS-VPR
Plasmid#188267PurposePlasmid ensures constitutive expression of the N-terminal fragment of split TRbeta (aa 200-412), fused to the VPR activation domain, a flexible GS linker and the SV40 NLS signal at the C-terminusDepositorInsertnTRb412 (TXNRD2 Human)
ExpressionMammalianAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
tdKatushka2-VASP-5
Plasmid#56049PurposeLocalization: Actin/Focal Adhesions, Excitation: 586, Emission: 632DepositorInsertVASP
TagstdKatushka2ExpressionMammalianMutationA209T in VASPPromoterCMVAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
Opto-GPR139
Plasmid#106044PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR139; Opto-GPR139; D10)DepositorInsertOpto-GPR139
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only