We narrowed to 895 results for: gcat
-
Plasmid#77458Purpose3rd generation lentiviral gRNA plasmid targeting human SGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
ATMIN gRNA (BRDN0001147857)
Plasmid#75860Purpose3rd generation lentiviral gRNA plasmid targeting human ATMINDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
Plasmid#209196PurposeMutagenesis of Cnr1DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUDE714
Plasmid#103021Purposeexpression of a Cpf1 programming crRNA targetting HIS4 (crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-SNCA-A53T
Plasmid#181738PurposeTransiently expressing a pegRNA to introduce SNCA-A53T mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A53T (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
MPP1 gRNA (BRDN0001148092)
Plasmid#77805Purpose3rd generation lentiviral gRNA plasmid targeting human MPP1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRRK2 gRNA (BRDN0001146754)
Plasmid#77330Purpose3rd generation lentiviral gRNA plasmid targeting human LRRK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK2 gRNA (BRDN0001145920)
Plasmid#76216Purpose3rd generation lentiviral gRNA plasmid targeting human NEK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK1 gRNA (BRDN0001146251)
Plasmid#76125Purpose3rd generation lentiviral gRNA plasmid targeting human NEK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PBK gRNA (BRDN0001145450)
Plasmid#75572Purpose3rd generation lentiviral gRNA plasmid targeting human PBKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationAnillin A740D, E758KPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PPP2R5D B12.5 gRNA
Plasmid#90854Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R5DDepositorInsertPPP2R5D (Guide Designation B12.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PPP2R2B B6.5 gRNA
Plasmid#90848Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R2BDepositorInsertPPP2R2B (Guide Designation B6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001487050)
Plasmid#77956Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 gRNA (BRDN0001145828)
Plasmid#76489Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgSat-MTSb/BFP/pdCas9-C1
Plasmid#162761PurposeExpressing dCas9 and sgRNA containg MTSa targeting centromeresDepositorInsertdCas9 and sgRNA(SL2-sgSat-MTSb)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
BRD2 gRNA (BRDN0001148966)
Plasmid#77985Purpose3rd generation lentiviral gRNA plasmid targeting human BRD2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PDGFRB gRNA (BRDN0001147806)
Plasmid#77059Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB.DEST-ITGB1(WT)-mRuby2
Plasmid#215448PurposePiggybac expression vector with integrin beta1 tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationSilent mutations added to disrupt shRNA binding a…PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Sxl].1046B
Plasmid#112692Purposeexpress two gRNA targeting bTub & Sxl under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] and U6.3-gRNA[Sxl] (Sxl Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode19
Plasmid#226196PurposeExpression mappingDepositorInsertSyn Barcode19
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-A
Plasmid#85216PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-A
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 2
Plasmid#193587PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 2 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
csr-1_qa-2_dsimpα_bar
Plasmid#251402PurposeEnables inducible expression of double-stranded RNA targeting importin α (NCU01249) under the control of the qa-2 promoter, with the expression cassette inserted at the csr-1 locus.DepositorInsertimportin alpha
UseRNAiAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#1-hygro
Plasmid#254678Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1 (#a)
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_3
Plasmid#242898PurposePiggyBac cargo vector with HNRNPK sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbATML1-2pro and NbATML1-1pro
Plasmid#231155PurposeT-DNA encoding TRV2 with mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertmobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
STK16 gRNA (BRDN0001145107)
Plasmid#75935Purpose3rd generation lentiviral gRNA plasmid targeting human STK16DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-3.3kb-USF
Plasmid#227475Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-2.4kb-USF
Plasmid#227477Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 2.4kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbATML1-2pro and NbATML1-1pro
Plasmid#231154PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertTREX2 and mobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSL1 C5.4 gRNA
Plasmid#90804Purpose3rd generation lentiviral gRNA plasmid targeting human NSL1DepositorInsertNSL1 (Guide Designation C5.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
DYNLL1 A8.5 gRNA
Plasmid#90661Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLL1DepositorInsertDYNLL1 (Guide Designation A8.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DYNLL1 A7.5 gRNA
Plasmid#90660Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLL1DepositorInsertDYNLL1 (Guide Designation A7.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
BUB1 A6.1 gRNA
Plasmid#90553Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1DepositorInsertBUB1 (Guide Designation A6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_TGIF2_2
Plasmid#72375PurposeEncodes gRNA for 3' target of human TGIF2 along with Cas9 with 2A GFPDepositorInsertTGIF2 (TGIF2 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only