176,067 results
-
Antibody#180082-rAbPurposeAnti-PSD-95 (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pZT-C13-R1
Plasmid#62197PurposeChr.13/CLYBL TALEN expression vectorDepositorInsertRight CLYBL TALEN
UseTALENPromoterCMVAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSUB11
Plasmid#169699PurposeTemplate plasmid for generating C-terminal 3xFLAG epitope tag fusions to bacterial genes by "Lambda red" recombineering.DepositorInsert3xFLAG tag adjacent to FRT-flanked aph (KanR) gene
Tags3xFLAG tagExpressionBacterialAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-TurboID(C )-HA-GPI
Plasmid#163697PurposeExpresses c-terminal half of TurboID on surface of astrocytesDepositorInsertGPI anchored TurboID
UseAAVAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-FnCas12a-TEV
Plasmid#174658PurposeFnCas12a expression plasmidDepositorInsertFnCas12a
UseCRISPRExpressionBacterialAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human SERCA2b (pcDNA3.1+)
Plasmid#75188PurposeMammalian expression of ATP2A2DepositorAvailable SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-mOVA
Plasmid#25099DepositorInsertmembrane bound ovalbumin
ExpressionBacterial and MammalianAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-zFucci-pA-exorh-GFP (JDW 1489)
Plasmid#242593PurposeA Tol2 expression vector containing the zebrafish Ubi promoter driving zFUCCI to label cell cycle state. Exorh-EGFP in the backbone to label pineal cells.DepositorInsertmCerulean-zGeminin, mCherry-zCdt1
UseZebrafish expressioPromoterzebrafish UbiAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZ M2rtTA_CAGG TetON-Sox10 with GFP
Plasmid#115241PurposeRMCE donor vector for inducible expression of SOX10 and GFP and constitutive expression of m2rtTA (generated from plasmid #112668)DepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (AAV1)
Viral Prep#100835-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (#100835). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p18sheLL
Plasmid#37321DepositorInsertHPV18L1+L2
ExpressionMammalianPromoterCMVAvailable SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
Cultivarium POSSUM Toolkit
Plasmid Kit#1000000234PurposeGolden Gate genetic toolkit developed to help researchers identify functional plasmids and establish genetic tractability in non-model bacteria.DepositorApplicationCloning and Synthetic BiologyVector TypeBacterial ExpressionCloning TypeGolden Gate (Loop)Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMS-II-PEST
Plasmid#204766PurposeGEMS 2.0 sensor system with PEST destabilization domain (pCMV-EGFP-PEST-m6Areporter-DHFR, Ef1a-APO1-YTH, hPGK-DsRed) (pFM577+PEST)DepositorInsertEGFP-PEST-m6Alinker-DHFR
Mutationmutated all RACs in EGFP to RGC/RCCPromoterCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA (AAV9)
Viral Prep#192552-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA (#192552). In addition to the viral particles, you will also receive purified pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA plasmid DNA. CAG-driven expression of nuclear localized tdTomato. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Thy1.1 DEST
Plasmid#17442PurposeDestination vector derived from MSCV-IRES-Thy1.1. Please note that this plasmid contains attB1 and attB2 sites for use in a BP reactionDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMAL-7xHis-TEV-hexa
Plasmid#222868PurposeExpresses His-tagged mutant (C19V/L56V/C110V/C130S/S135G/S219V) TEV protease in E. coliDepositorInsertTEV protease
Tags7xHis and MBPExpressionBacterialMutationC19V, L56V, C110V, C130S, S135G, S219V. Insert in…Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
CD8a
Plasmid#86050PurposeA mammalian expression plasmid encoding CD8a without tag.DepositorAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (AAV5)
Viral Prep#111568-AAV5PurposeReady-to-use AAV5 particles produced from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (#111568). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid DNA. GfaABCD1-driven, expression of mCherry fused plasma membrane calcium pump hPMCA2w/b. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV V5-LUC Blast (w567-1)
Plasmid#21474Purpose3rd gen lentiviral V5-Luciferase expression vector, CMV promoter, BlastDepositorInsertV5-LUC
UseLentiviral and LuciferaseTagsV5ExpressionMammalianAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
ER-GCaMP6-150
Plasmid#86918PurposeFluorescent reporter for ER calcium signalingDepositorInsertER-GCaMP6-150
UseLentiviralExpressionMammalianMutationK78H, T302L, R303P, A317E, D324G, D360G, D380Y, T…PromoterCAMKIIAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-RfxCas13d-His
Plasmid#141322PurposePlasmid for bacterial expression and purification of RfxCas13d proteinDepositorInsertRfx-Cas13d
UseCRISPRTags6xHisExpressionBacterialPromoterT7Available SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCVneo-HA-ER-Hoxb8
Plasmid#222291PurposeThe most commonly used plasmid for the generation of ER-Hoxb8 conditionally immortalized myeloid cell lines.DepositorUseRetroviralTagsHAExpressionMammalianMutationThe estrogen receptor hormone binding domain cont…Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pylT-N346A/C348A
Plasmid#127411PurposeDouble mutant of wild type mmPylRS designed for incorporation of non-canonical amino acids with mono-substituted phenylalanine derivatives and tyrosinyl ethersDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialMutationN346A-C348APromoteraraBADAvailable SinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro eGFP
Plasmid#140027PurposeTunable and temporal expression control of nuclear eGFPDepositorInsertEnhanced Green Fluorescent Protein
UseSynthetic BiologyExpressionMammalianPromoterTRE3GAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRY2PHR-mCherryN1
Plasmid#26866PurposeExpresses CRY2(1-498)-mCherry fusion for use in light-inducible protein interaction modulesDepositorAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-SCN8A-Variant-1-IRES-mScarlet
Plasmid#162280PurposeEukaryotic expression of human SCN8A variant 1 isoform. This channel has been modified to be stably maintained in standard bacterial strains.DepositorInsertSCN8A Variant 1, stabilized (SCN8A Human)
TagsIRES-mScarletExpressionMammalianMutationModified human HSPA5 intron 4 inserted after bp23…PromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTU2-AmyE-Pveg-eGFP
Plasmid#112792PurposeExpresses GFP under the control of Pveg promoter and it is integrated into AmyE locus. Used to test correct transformationDepositorArticleInsertPveg-eGFP
ExpressionBacterialAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bidirectional MYC 5'UTR Dual Fluorescence Reporter
Plasmid#229498PurposeThis is a lentiviral reporter for translation initiation under the control of the Myc 5'UTR, which produces destabilized GFP (dsGFP). There is a control destabilized mCherry (dsmCherry) as a control.DepositorInsertMYC 5'Untranslated region + destabilized GFP
UseLentiviralExpressionMammalianPromoterEf1aAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only