We narrowed to 31,039 results for: SON
-
Plasmid#105285Purposedrives expression of V5-NES-APEX2-GFP from human PGK promotorDepositorInsertV5-APEX2-NES
TagsGFPExpressionMammalianPromoterhuman PGK promoterAvailable SinceOct. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-LiLac
Plasmid#184570PurposeFluorescent reporter for lactate (with lifetime and intensity response); expresses in mammalian cells and can be packaged as AAVDepositorHas ServiceAAV8InsertLiLac fluorescent sensor of lactate
UseAAVTagsHis7ExpressionMammalianPromoterCAGAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET30a-HS-Tn5
Plasmid#127916PurposeProkaryotic expression of Hyperstable Tn5 (HS-Tn5) for Illumina library preperation. Developed for the large scale ChIP-Seq and ATAC-Seq experiments for the fruitENCODE and Maize Cistrome projects.DepositorInsertHyperstable Tn5
TagsE coli elongation factor Ts and Mxe intein - Chit…ExpressionBacterialMutationE54K, L372PPromoterT7Available SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGex-4T-2_GABARAP
Plasmid#73948PurposeFor recombinant expression of human GABARAP in E.coliDepositorAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HyPer-DAAO-NES
Plasmid#119164PurposeFusion of hydrogen peroxide fluorescent biosensor HyPer and D-amino acid oxidase; excluded from nucleus. Allows H2O2 production/detection by adding D-amino acids. AAV expression vector; CMV promoter.DepositorInsertHyPer-DAAO-NES
UseAAVTagsNESExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGF196
Plasmid#97005PurposeExpresses LEMD2-mCherry in mammalian cells under a crippled promoterDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
mApple-Golgi-7
Plasmid#54907PurposeLocalization: Golgi Complex, Excitation: 568, Emission: 592DepositorInsertGolgi (B4GALT1 Human)
TagsmAppleExpressionMammalianMutationaa 1-82 of NM_001497.3PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB-U6insert
Plasmid#104536PurposeA piggybac vector with a U6 promoter that allows cloning of guide RNAsDepositorTypeEmpty backboneUseCRISPR, Mouse Targeting, and Synthetic Biology ; …ExpressionMammalianPromoterU6Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDE-35S-Cas9-mCherry
Plasmid#78931PurposeFor CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plantsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR-JNKKTRClover
Plasmid#59139PurposeORF encoding JNK KTR mClover flanked by Gateway sequencesDepositorInsertJNK Kinase Translocation Reporter (MAPK8 Human, Mouse)
Available SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA C12 ecDHFR DD YFP HA
Plasmid#192815PurposeExpresses an N-terminal enhanced destabilizing domain (DD) version of E. coli DHFR with higher basal turnover in mammalian systems. Contains missense mutations W74R/T113S/E120D/Q146L.DepositorInsertE. coli dihydrofolate reductase
Tagsenhanced yellow fluorescent protein and hemagglut…ExpressionMammalianMutationW74R/T113S/E120D/Q146LPromoterCMVAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW-SPI1
Plasmid#162824PurposeDoxycycline-inducible overexpression of human SPI1DepositorAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-SpG-P2A-GFP
Plasmid#159980PurposePrime editing in mammalian cellsDepositorInsertPE2-SpG-P2A-GFP
TagsBpSV40 NLSExpressionMammalianPromoterCMVAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6p1-GST-ArcFL
Plasmid#119877PurposeBacterial Expression construct for protein production and purificationDepositorAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETDuet_sfCherry2(1-10)_sfCherry2(11)-SpyCatcher
Plasmid#117656PurposeBacterial expression vector for split sfCherry3 screening. The “sfCherry2(1-10)” and “sfCherry2(11)-SpyCatcher002” are expressed from two different T7 promoters.DepositorInsertssfCherry2(1-10)
sfCherry2(11)-SpyCatcher002
ExpressionBacterialPromoterT7Available SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-BFP
Plasmid#188775PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9-mTagBFP2
UseLentiviralTagsHA-2xNLS-mTagBFP2 and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
eGFP-KIF5B
Plasmid#172203PurposeExpresses KIF5B tagged with eGFP in mammalian cellsDepositorAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-Halo
Plasmid#175296PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with HaloTag
TagsHaloTagExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
TagRFP-T_A1aY1
Plasmid#158751PurposeLentiviral vector for expression of TagRFP-T_A1aY1 in mammalian cells for detection of tyrosinated microtubules.DepositorInsertTagRFP-T_A1aY1
UseLentiviralTagsTagRFP-TExpressionMammalianPromoterCAG (CMV enhancer and chicken beta actin promoter)Available SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only