Showing: 41 - 60 of 1684 results
-
Plasmid#172480PurposeH2B-sfGFP with a synthetic intron from the pCI expression vector, T2A, and tdTomato with synthetic introns derived from the rabbit beta-globin gene and the human beta-globin geneDepositorInsertH2B-sfGFP-T2A-tdTomato
UseCre/LoxTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
Plasmid#67277Purposeinducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.DepositorInsertsfirst casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
second cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
UseTagsmTQ2 blue fluorescent and red flourescent gene ka…ExpressionMammalianMutationPromoterCAGAvailabilityAcademic Institutions and Nonprofits only -
The Expanded EasyClone-MarkerFree toolkit
Plasmid Kit#1000000190PurposeThe Expanded EasyClone-MarkerFree toolkit is a new set of 8 validated chromosomal loci for the stable integration of heterologous DNA into baker’s yeast Saccharomyces cerevisiae.DepositorAvailabilityAcademic Institutions and Nonprofits only -
-
-
pcDNA3.Flag.HERC2-HECT-WT.6xHis
Plasmid#39227DepositorInsertHERC2 HECT Domain (HERC2 Human)
UseTags6xHis and FlagExpressionMammalianMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.Flag.HERC2-HECT-C4762A.6xHis
Plasmid#39228DepositorInsertHERC2 HECT Domain (HERC2 Human)
UseTags6xHis and FlagExpressionMammalianMutationC4762APromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-RdLight1 (AAV9)
Viral Prep#125707-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-RdLight1 (#125707). In addition to the viral particles, you will also receive purified pAAV-CAG-RdLight1 plasmid DNA. CAG-driven expression of red genetically encoded dopamine sensor RdLight1. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsNoneAvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-RdLight1 (AAV9)
Viral Prep#125708-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-RdLight1 (#125708). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-RdLight1 plasmid DNA. Synapsin-driven expression of red genetically encoded dopamine sensor RdLight1. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailabilityAcademic Institutions and Nonprofits only -
pCMV-MtPylRS (human-opti)
Plasmid#164080PurposeTo express a Methanosarcina thermophila derived PylRS in mammalian cells for genetic code expansionDepositorInsertMtPylRS-478(human-opti)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCMV-MfPylRS (human-opti)
Plasmid#164081PurposeTo express a Methanosarcina flavescens derived PylRS in mammalian cells for genetic code expansionDepositorInsertMfPylRS(human-opti)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCMV-MtAcKRS (human-opti)
Plasmid#164195PurposeTo express a Methanosarcina thermophila derived AcKRS in mammalian cells for genetic code expansionDepositorInsertMtAcKRS-478(human-opti)
UseSynthetic BiologyTagsExpressionMammalianMutationD76G; L325M; L329I; Y330F; L333A; C372FPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCMV-MfBulKRS (human-opti)
Plasmid#164196PurposeTo express a Methanosarcina flavescens derived BulKRS in mammalian cells for genetic code expansionDepositorInsertMf BulKRS(human-opti)
UseSynthetic BiologyTagsExpressionMammalianMutationY269A;Y347FPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q48
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DnpK
Plasmid#71403PurposeExpresses tRNA and synthetases for mammalian encoding of a dinitrophenyl hapten, DnpKDepositorInsertaminoacyl-tRNA synthetase
UseTagsExpressionMammalianMutationY271M,L274T,C313A, and Y349FPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pC1-HyPer-2
Plasmid#42211PurposeA genetically encoded sensor for H2O2 with expanded dynamic range.DepositorInsertHYPER 2
UseTagsExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
Drosophila_sgRNA_group_2
Pooled Library#134583PurposeTargets Drosophila orthologs of vertebrate genes that have undergone expansion in the vertebrate lineDepositorExpressionInsectSpeciesDrosophila melanogasterUseCRISPRAvailabilityAcademic Institutions and Nonprofits only -
gCOTS-pyl
Plasmid#92048PurposeThis is a S. elongatus (PCC7942) shuttle vector used for recombination of the pylRS orthogonal translation system to genomic neutral site 2.DepositorInsertsPyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseCyanobacteria s. elongatus genome recombination i…TagsExpressionMutationPromoterLeuP (native S. elongatus promoter) and PrcbLAvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(92Q)-S776D
Plasmid#21757DepositorInsertAtaxin-1 (ATXN1 Human)
UseTagsGSTExpressionMammalianMutationinsert contains a stretch of 92 Q(Glutamines) and…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only
Showing: 41 - 60 of 1684 results