We narrowed to 24,790 results for: Spr
-
Plasmid#75562Purpose3rd generation lentiviral gRNA plasmid targeting human NEK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MKNK1 gRNA (BRDN0001146808)
Plasmid#75512Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKNK1 gRNA (BRDN0001146937)
Plasmid#75513Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKNK1 gRNA (BRDN0001148208)
Plasmid#75514Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK10 gRNA (BRDN0001148022)
Plasmid#75487Purpose3rd generation lentiviral gRNA plasmid targeting human STK10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK10 gRNA (BRDN0001149099)
Plasmid#75488Purpose3rd generation lentiviral gRNA plasmid targeting human STK10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK10 gRNA (BRDN0001162510)
Plasmid#75489Purpose3rd generation lentiviral gRNA plasmid targeting human STK10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK10 gRNA (BRDN0001162500)
Plasmid#75490Purpose3rd generation lentiviral gRNA plasmid targeting human STK10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NLK gRNA (BRDN0001146865)
Plasmid#75481Purpose3rd generation lentiviral gRNA plasmid targeting human NLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NLK gRNA (BRDN0001147584)
Plasmid#75482Purpose3rd generation lentiviral gRNA plasmid targeting human NLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NLK gRNA (BRDN0001147680)
Plasmid#75483Purpose3rd generation lentiviral gRNA plasmid targeting human NLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
UCK1 gRNA (BRDN0001148467)
Plasmid#77419Purpose3rd generation lentiviral gRNA plasmid targeting human UCK1DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146095)
Plasmid#77278Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
TEX14 gRNA (BRDN0001146944)
Plasmid#76831Purpose3rd generation lentiviral gRNA plasmid targeting human TEX14DepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
PANK1 gRNA (BRDN0001147091)
Plasmid#76558Purpose3rd generation lentiviral gRNA plasmid targeting human PANK1DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPF4B gRNA (BRDN0001146471)
Plasmid#76430Purpose3rd generation lentiviral gRNA plasmid targeting human PRPF4BDepositorInsertPRPF4B
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
PANK3 gRNA (BRDN0001148598)
Plasmid#76294Purpose3rd generation lentiviral gRNA plasmid targeting human PANK3DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
OXSR1 gRNA (BRDN0001149240)
Plasmid#77749Purpose3rd generation lentiviral gRNA plasmid targeting human OXSR1DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
OXSR1 gRNA (BRDN0001148375)
Plasmid#77750Purpose3rd generation lentiviral gRNA plasmid targeting human OXSR1DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
UCK2 gRNA (BRDN0001145127)
Plasmid#75765Purpose3rd generation lentiviral gRNA plasmid targeting human UCK2DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK11 gRNA (BRDN0001147265)
Plasmid#75563Purpose3rd generation lentiviral gRNA plasmid targeting human NEK11DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYO3B gRNA (BRDN0001145445)
Plasmid#75569Purpose3rd generation lentiviral gRNA plasmid targeting human MYO3BDepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Neo_CAG-Cas9
Plasmid#86698PurposeCas9 expression vector for targeting to the AAVS1 locusDepositorInsertCas9
UseCRISPRExpressionMammalianPromoterpCagAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
JG1211: CAG-human dLbCpf1(D832A)-NLS-3xHA-VPR
Plasmid#104567PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to VPR activatorDepositorInserthuman codon optimized ‘dead’ Cpf1 fused to HSV VPR activation domain
UseCRISPRTagsNLS-3xHA-VPRExpressionMammalianMutationD832APromoterCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a-TET1-dCas9
Plasmid#235593PurposeTet1CD fused to N-terminus of dCas9DepositorInsertTET1-dCas9 (TET1 Human, SpCas9 is from Streptococcus pyogenes)
UseCRISPRTags3xNLS, TET1 CD, and tagBFPExpressionMammalianPromoterEF1aAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC013 - Twinstrep-SUMO-huLwCas13a
Plasmid#90097PurposeTwinstrep-SUMO-huLwCas13a for recombinant protein bacterial expression. Insert is human codon optimized but expresses well in bacteria.DepositorInsertLwCas13a
UseCRISPRTags6xHis-Twin Strep-SUMOExpressionBacterialAvailable SinceJune 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLQ4428 pHR (EF1a-mCherry-P2A-RfxCas13d-2xNLS-ecDHFR-3xFLAG-WPRE)
Plasmid#214885PurposeLentiviral vector encoding TMP-regulatable RfxCas13d-DD fusionDepositorInsertEF1a-mCherry-P2A-RfxCas13d-2xNLS-ecDHFR-3xFLAG-WPRE
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEF1aAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpG-P2A-EGFP (RTW4552)
Plasmid#139998PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9 variant named SpG with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpG=D1135L/S1136W/G1218K/E1219Q/R13…PromoterCAGAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dual-sgRNA_hU6-mU6
Plasmid#154194PurposeLentiviral expression plasmid for two sgRNAs from a hU6 and a mU6 promoter. The cloning site design allows a one-step cloning strategy of both sgRNAs. Expresses a Thy1.1 marker.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-hHDAC3
Plasmid#98591Purpose3rd generation lenti vector encoding dCas9-hHDAC3 (EF1a-NLS-dCas9(N863)-hHDAC3). Expresses dCas9 fused to human HDAC3.DepositorInsertdCAS9-HDAC3 (HDAC3 Synthetic, S. pyogenes, Human)
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1AAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
CARPID BASU-dCasRx
Plasmid#153209Purposeexpress CARPID BASU-dCasRx fusion protein in mammalian cellsDepositorInsertBASU-dCasRx
UseCRISPR and LentiviralExpressionMammalianMutationR239A/H244A/R858A/H863A in RfxCas13dPromoterEF-1aAvailable SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
CARPID dCasRx-BASU
Plasmid#153303Purposeexpress CARPID dCasRx-BASU fusion protein in mammalian cellsDepositorInsertdCasRx-BASU
UseCRISPR and LentiviralExpressionMammalianMutationR239A/H244A/R858A/H863A in RfxCas13dPromoterEF-1aAvailable SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpCas9-NG-P2A-EGFP (RTW4554)
Plasmid#140001PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9-NG with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCAGAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas-hHDAC3-R265P
Plasmid#103786PurposeExpresses dCas9 fused to human HDAC3 with R265P mutationDepositorInsertdCas9-HDAC3-R265P (HDAC3 Synthetic, S. pyogenes, Human)
UseCRISPR and LentiviralExpressionMammalianMutationChanged arginine 265 to prolinePromoterEF1AAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN089
Plasmid#91614PurposeExpress sgRNA targeting human FURINDepositorAvailable SinceOct. 12, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-VP64-BFP
Plasmid#46912PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFPDepositorInsertsdCas9-VP64-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags3xNLS, BFP, and VP64 domainExpressionMammalianPromoterLTR and PGKAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-MGAT1-KO
Plasmid#80009PurposegRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans.DepositorInsertMGAT1 (MGAT1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001148399)
Plasmid#76842Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmax
Plasmid#206883PurposeExpresses FLAG-tagged PEmax fused to Gag through a linker sequenceDepositorInsertPEmax
UseCRISPR and LentiviralTagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001148961)
Plasmid#77967Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001145317)
Plasmid#77965Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001487120)
Plasmid#77966Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-dCas9-KRAB-PGK-HygR
Plasmid#83890PurposeLentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette.DepositorInsertshumanized dead Cas9 KRAB
aminoglycoside phosphotransferase from E. coli
UseCRISPR and LentiviralTagsFlagMutationD10A and H840APromoterHuman Ubiquitin C Promoter and mouse phosphoglyce…Available SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146194)
Plasmid#75913Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only