We narrowed to 42,665 results for: cha;
-
Plasmid#110849PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGExpressionMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-Puro
Plasmid#110850PurposeLentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGExpressionMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-PGK-Puro
Plasmid#110855PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGExpressionMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-PGK-Puro
Plasmid#110856PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGExpressionMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT_S285C
Plasmid#98665PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285CDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationS285CPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT_S329C
Plasmid#98667PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S329CDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationS329CPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V
Plasmid#98658PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D290VDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationD290VPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D220V
Plasmid#98659PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D220VDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationD220VPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D230V
Plasmid#98660PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D230VDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHisExpressionBacterialMutationD230VPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L
Plasmid#104465Purposeexpress His tagged P298L hnRNPA2 LCDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsHisExpressionBacterialMutationP298LPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R254K
Plasmid#104466Purposeexpress MBP hnRNPA2 LC with 2 R to K mutationsDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsHis-MBPExpressionBacterialMutationR191K R254KPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L_S329C
Plasmid#104470Purposeexpress His tagged P298L S329C hnRNPA2 LCDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsHisExpressionBacterialMutationP298L S329CPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
5` CC: Puro – loxP – GFP-C
Plasmid#219563Purpose5` circularization cassette.Used in combination with one of the 3' circularization cassettes to induce Cre-mediated circularizazion or inversion of a desired genomic region.DepositorInserthPGK-promoter_PuroR_2A_loxP_GFP-C
UseUnspecifiedTagsExpressionMutationPromoterhPGKAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – GFP-N – loxP – mScarlet
Plasmid#219564Purpose3` circularization cassette.To induce Cre-mediated circularization or inversion of a genomic region with concomitant GFP reconstitution and mScarlet expression from the chromosomeDepositorInsert3` CC: Hygro – GFP-N – loxP – mScarlet
UseUnspecifiedTagsExpressionMutationPromoterEF1-aAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_M18
Plasmid#82357PurposeExpression plasmid coding for heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18.DepositorInsertmouse immunoglobulin heavy chain IgG1 isotype (Ighg1 Mouse)
UseTagsnoneExpressionMammalianMutationnonePromoterhEF1-HTLV promAvailable sinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoSTIM1
Plasmid#70159PurposeMammalian expression plasmid of OptoSTIM1 (optogenetically-activated STIM1 protein)DepositorInsertOptoSTIM1 (STIM1 Human, Mustard Weed)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-mScarletP2A-hLuc
Plasmid#218793PurposeAAV reporter genome plasmidDepositorInsertNLSf-mScarletP2A-hLuc
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-tet-iCas9-BFP2
Plasmid#125519Purposeall-in-one-inducible Cas9DepositorInsertAAVS1-TET-ON 3G-SpCas9-P2A-BFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcBac2.tR4-OMeYRS/GFP*
Plasmid#50831Purposebaculovirus-based delivery system that enables the efficient incorporation of unnatural amino acids into proteins in mammalian cellsDepositorInsertstwo-copy Tyr tRNA cassette
EGFP*
OMeYRS
two copy Tyr tRNA cassette
UseBaculoviralTagsHis, Myc-6xHis, and WPREExpressionInsectMutationY39TAG and able to charge various unnatural amino…PromoterCAG, CMV, and U6 and H1Available sinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Eomes-3xT7
Plasmid#200888PurposeInducible lentiviral expression of EomesDepositorInsertEomes (Eomes Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianMutationPromoterTRE promoter, Tet ONAvailable sinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-SCN8A-Variant-1-IRES-mScarlet
Plasmid#162280PurposeEukaryotic expression of human SCN8A variant 1 isoform. This channel has been modified to be stably maintained in standard bacterial strains.DepositorInsertSCN8A Variant 1, stabilized (SCN8A Human)
UseTagsIRES-mScarletExpressionMammalianMutationModified human HSPA5 intron 4 inserted after bp23…PromoterCMVAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-rsChRmine-oScarlet-WPRE
Plasmid#183522PurposeOptogeneticsDepositorInsertrsChRmine-oScarlet
UseAAVTagsExpressionMutationI146M/G174SPromoterCaMKIIaAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CBA-hGBA1-HA-hGHpA
Plasmid#218794PurposeAAV reporter genome plasmidDepositorInsertCMV-CBA-hGBA1-HA-hGHpA
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-mCherry-sspB
Plasmid#121968PurposeExpresses fusion of disordered protein BRD4(462-1362), fluorescent protein mCherry, and sspB which upon light activation binds to iLID.DepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsmCherry-sspBExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FNLS-P2A-GFP-PGK-Puro
Plasmid#110869PurposeLentiviral vector for constitutive expression of FNLS-P2A-GFP in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGExpressionMutationD10A and NLS sequence at the N-terminusPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC-G418-YR
Plasmid#61767PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing nptII (neomycin phosphotransferase II) selectable marker on transfer DNA (TDNA).DepositorInsertsnptII gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…TagsExpressionMutationPromotertrpC promoterAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-P2A-GFP-PGK-Puro
Plasmid#110861PurposeLentiviral vector for constitutive expression of Cas9-VQR-P2A-GFP (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGExpressionMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-single(U6-sgRNA(backbone))-ITR
Plasmid#207880PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and single sgRNA cloning site w/ the engineered Sa Guide scaffold variant (BbsI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti- V6.3 lox-dsRED-stop-lox-eGFP-blas
Plasmid#106171Purposecre mediated red to green shiftDepositorInsertsdsRED-express2
eGFP
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROS17
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMIG-IRF4
Plasmid#58987PurposeMSCV based expression vector - co-expresses GFP and murine IRF4DepositorInsertMouse IRF4 (Irf4 Mouse)
UseRetroviralTagsKozak sequence addedExpressionMammalianMutationPromoterMSCVAvailable sinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only