We narrowed to 2,586 results for: PLS
-
Plasmid#176567PurposeExpression of Sapphire for auxotrophic selection in the absence of uracilDepositorInsertyETSapphire
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcw107
Plasmid#62511PurposeGateway Expression VectorDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterPGKAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGTM_COV2_NSP3_003_SUMO
Plasmid#233739PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of an active PLpro protease. Following Sumo Protease cleavage no nonnative residues remain on the PLpro proteinDepositorAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLPT234
Plasmid#127855PurposeRepressilator 2.0, without degradation tags, integrated triple reporterDepositorInsertsbla
mSCFP3
mKate2
mVenus
TetR
LacI
cI
UseSynthetic BiologyExpressionBacterialMutationFirst 11aa derived from mCherry as fusion proteinPromoterpAmpR, pL LacO1, pL tetO1, and pRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3 basic E2
Plasmid#48747PurposeExpression of luciferase driven by mPer2 promoter fragment containing E-box2 (bases -112 to +98 with respect to transcription start site at +1)DepositorInsertmPer2 promoter/enhancer region containing E-box2 (-112 to +98)
UseLuciferaseAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRetroX GFP T2A Cre
Plasmid#63704PurposeInducible expression of GFP T2A Cre fusion in mammalian cellsDepositorInsertT2A Cre
UseRetroviralTagsEGFPExpressionMammalianPromotertight TRE promoterAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Gβ-2A-cpV-Gγ2-IRES-Gαi2-mTq2
Plasmid#69624PurposeA FRET sensor for Galphai2 activation, encoded on a single plasmid.DepositorInsertsGbeta-2A-cpV-Ggamma2
Galphai2-mTurquoise2
Tagsciruclar permutated Venus (cp173V) and mTurquoise…ExpressionMammalianPromoterCMV and CMV (IRES)Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Gβ-2A-cpV-Gγ2-IRES-Gαi1-mTq2
Plasmid#69623PurposeA FRET sensor for Galphai1 activation, encoded on a single plasmid.DepositorInsertsGbeta-2A-cpV-Ggamma2
Galphai-mTurquoise2
Tagsciruclar permutated Venus (cp173V) and mTurquoise…ExpressionMammalianPromoterCMV and CMV (IRES)Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
hTPST2
Plasmid#11253DepositorAvailable SinceJan. 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk12_Nterm_FlagHa
Plasmid#127177PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk12 transgene (NM_001109626.1 isoform) cloned into Gateway entry vectorDepositorInsertN-terminally Flag- HA- Epitope Tagged Mouse Cyclin Dependent Kinase 12 (Cdk12 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesPromoterNoneAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Gβ-2A-cpV-Gγ2-IRES-Gαi3-mTq2
Plasmid#69625PurposeA FRET sensor for Galphai3 activation, encoded on a single plasmid.DepositorInsertsGbeta-2A-cpV-Ggamma2
Galphai3-mTurquoise2
Tagsciruclar permutated Venus (cp173V) and mTurquoise…ExpressionMammalianPromoterCMV and CMV (IRES)Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
hTPST1
Plasmid#11252DepositorAvailable SinceJan. 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGL3 Pro E2
Plasmid#48749PurposeExpression of luciferase driven by mPer2 promoter fragment containing E-box2 (bases -112 to +98 with respect to transcription start site at +1) and SV40 promoter (backbone)DepositorInsertmPer2 promoter/enhancer region containing E-box2 (-112 to +98)
UseLuciferaseAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk12_Untagged
Plasmid#127178PurposeUntagged mouse Cdk12 transgene (NM_001109626.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertMouse Cyclin Dependent Kinase 12 (Cdk12 Mouse)
UsePiggybac transposase vectorTagsNoneExpressionMammalianPromoterTetO PromoterAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-M3(T3D)471-721
Plasmid#56657PurposeGFP reporter for cytoplasmic inclusions formed by the fused, C-terminal region of protein muNS from mammalian orthoreovirus Type 3 DearingDepositorInsertM3(T3D)421-721
TagsEGFPExpressionMammalianMutationinsert encodes aa 471-721 + native stop codon of …PromoterCMV-IEAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-HKIImut
Plasmid#99240PurposeType II Hexokinase expressed in AS-30D rat hepatoma cell lineDepositorInsertHexokinase II (Hk2 Rat)
ExpressionMammalianMutationFour silent mutations; P (115)L, A (192) V, F (78…PromoterCMV I.E.Available SinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pAhpC-RBS- LacZ
Plasmid#190060PurposeLacZ containing colorimetric reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pAhpC promoterDepositorInsertlacZ
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pAhpC-RBS- sfGFP
Plasmid#190051PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pAhpC promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pT7-soxA
Plasmid#190057PurposeExpress the bacterial monomeric sarcosine oxidase enzyme under the control of the strong constitutif phage promoter T7DepositorInsertSoxA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-pDUXChd:hDUX4ctd-ca
Plasmid#198237PurposeLentivector with tet-inducible porcine DUXC/human DUX4 chimera (codon altered)DepositorInsertDUX4L pDUXChd:hDUX4ctd (codon altered) (DUX4 Human, S. scrofa (porcine))
UseLentiviralExpressionMammalianMutationcodon alteredPromoterTREAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBB0323-TEV-His12
Plasmid#137039Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0323 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66700.1
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-D
Plasmid#64516PurposeAS-30D hepatoma hexokinase II 1.0 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase II promoterAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGTM_SUMO_PLpro_W93F_001
Plasmid#234490PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of PLpro protease with a W93F mutation to allow for 5-fluorotryptophan incorporation and 19F NMRDepositorInsertPLpro
Tags6xHis-SumoExpressionBacterialPromoterT7 lacAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGTM_SUMO_PLpro_W106F_001
Plasmid#234491PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of PLpro protease with a W106F mutation to allow for 5-fluorotryptophan incorporation and 19F NMRDepositorAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pT7-lox
Plasmid#190059PurposeExpress the bacterial lactate oxidase enzyme under the control of the strong constitutif phage promoter T7DepositorInsertlox
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pT7-codA
Plasmid#190058PurposeExpress the bacterial choline oxidase enzyme under the control of the strong constitutif phage promoter T7DepositorInsertcodA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pYjjZ-RBS- sfGFP
Plasmid#190054PurposeGFP containing reporter plasmid expressing it under the control of the reportedely OxyR/H2O2 inducible pYjjZ promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pKatG-RBS- sfGFP
Plasmid#190053PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pKatG promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pOxyS-RBS- sfGFP
Plasmid#190052PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pOxyS promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBB0238-TEV-His12
Plasmid#137038Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0238 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66635.2
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-F
Plasmid#64518PurposeAS-30D hepatoma hexokinase II 0.075 kbp exon I-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase II promoter deletedAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flag-SIRT1
Plasmid#1791PurposeMammalian expression of flag-tagged SIRT1DepositorAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pHtrA-TEV-His12
Plasmid#137036Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi HtrA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66500.2 (BB_0104 Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Flag-SIRT1 H363Y
Plasmid#1792DepositorInsertSIRT1 (SIRT1 Human)
TagsFlagExpressionMammalianMutationH363Y, deacetylase domain mutationAvailable SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FOXO3a WT
Plasmid#8360DepositorAvailable SinceMarch 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
Luciferase-pcw107-V5
Plasmid#64649Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5PromoterPGKAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVX-dL5**-mCER-TRF1
Plasmid#168176PurposeExpresses FAP (dL5**) fused to mCerulean and the telomere binding protein TRF1DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FOXO3a TM
Plasmid#8361DepositorAvailable SinceFeb. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Tet-MKK6(DD)-Puro
Plasmid#86094PurposeTet/Dox inducible (TetR) constitutively active mutant MKK6/MAP2K6 in lentiviral vectorDepositorInsertMKK6 (MAP2K6 Human)
UseLentiviralTagsMyc tagExpressionMammalianMutationSerine 207 and Threonine 211 both changed to Aspa…PromoterCMV/TetOAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
cpVenus-Gγ2
Plasmid#69626PurposeThe heterotrimeric G-protein subunit, Gγ2, tagged with circular permutated Venus (cp173V).DepositorInsertcp173Venus-Ggamma2 (GNG2 Synthetic)
Tagsciruclar permutated Venus (cp173V)ExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B3
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3 basic Mut E2
Plasmid#48748PurposeExpression of luciferase driven by mPer2 promoter fragment containing mutated E-box2 (bases -112 to +98 with respect to transcription start site at +1)DepositorInsertmPer2 promoter/enhancer region containing mutated E-box2 (-112 to +98)
UseLuciferaseMutationMutated E-box2 sequence from CACGTT to GCTAGTAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-mycRSK2wt
Plasmid#15827DepositorInsertRibosomal S6 kinase 2 (Rps6ka3 Mouse)
UseRetroviralTagsmycExpressionMammalianMutationwild typeAvailable SinceNov. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-BB0323-ss
Plasmid#137067PurposeE. coli expression clone (T7lac promoter) for mature BB0323 (aa 20-377) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66700.1
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature BB0323: lacks the BB0323 signal peptidePromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIG-FGFRdn
Plasmid#80431PurposeExpression of a dominant-negative FGFR1 with a nuclear EGFP reporter in chick embryosDepositorInsertFibroblast growth factor receptor 1 (FGFR1 Chicken)
TagsEGFPExpressionMammalianMutationcontains aa 1–425Promoterbeta-actin promoterAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk12_Nterm_FlagHa
Plasmid#127179PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk12 transgene (NM_001109626.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertN-terminally Flag- HA- Epitope Tagged Mouse Cyclin Dependent Kinase 12 (Cdk12 Mouse)
UsePiggybac transposase vectorTagsFlag- HA- Tandem EpitopesExpressionMammalianPromoterTetO PromoterAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDipA-TEV-His12
Plasmid#137042Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi DipA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66790.1 (BB_0418 Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only