We narrowed to 2,336 results for: control GFP
-
Plasmid#113040PurposeAAV vector; encodes GFP as well as a U6-driven EMX1-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA EMX1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CFTR gRNA (SpyCas9 scaffold)
Plasmid#113042PurposeAAV vector; encodes GFP as well as a U6-driven CFTR-targeting gRNA (SpyCas9 scaffold)DepositorInsertCFTR gRNA (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP G protein Gamma 3(A73L,L74I,L75S) in pcDNA3.1
Plasmid#42190DepositorInsertG protein Gamma 3(A73L,L74I,L75S) (Gng3 Mouse)
TagsEGFPExpressionMammalianMutationA73L,L74I,L75SPromoterCMVAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre;3xP3-gTc’v-SV40]
Plasmid#124068PurposeCRISPR/Cas mediated knock-in via non-homologous end-joining in Tribolium; bhsp drives EGFP expression; Dm-ebony for linearization; (Transformation plasmid; Black eye marker)DepositorInserteb-Tc’bhsp-EGFP-2A-Cre; 3xP3-gTc’v-SV40
UseCRISPR and Cre/LoxExpressionInsectPromoterbhsp68Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG Retro EGFP Puro
Plasmid#234463PurposeControl retroviral vector expressing Green Fluorescent Protein. Puromycin selection.DepositorInsertGreen Fluorescent Protein
UseRetroviralAvailable SinceMarch 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG Retro EGFP Hygro
Plasmid#234462PurposeControl retroviral vector expressing Green Fluorescent Protein. Hygromycin selection.DepositorInsertGreen Fluorescent Protein
UseRetroviralAvailable SinceMarch 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
INCTbiosyn-p35S(rc)2_4_5-GFP
Plasmid#127520PurposePlasmid has an inverted CaMV 35S promoter sequence (reverse complement) flanked by attB and attP attachment sites of integrases 2, 4, and 5. EGFP coding sequence is in the forward orientation.DepositorInsertCaMV 35S reverse complement promoter sequence flanked by attB/attP Integrase 2, 4 and 5 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)Bxb1
Plasmid#127511PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)phiC31
Plasmid#127510PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)phiC31
Plasmid#127527PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)Bxb1
Plasmid#127528PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXspuro-GFP
Plasmid#74203PurposeRetroviral control vector containing GFP insertDepositorInsertGFP
UseRetroviralExpressionMammalianAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-X0
Plasmid#115565PurposeControl vector expressing GFP alone without any consensus repeatsDepositorInsertGreen Fluorescent Protein
ExpressionBacterial and YeastPromoterADH1Available SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG Lenti CMV EGFP Puro
Plasmid#236084PurposeLentiviral backbone expressing EGFP, control for empty backbone 236083DepositorInsertEGFP
UseLentiviralPromoterCMVAvailable SinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CamKIIa(0.4)-stChrimsonR-EGFP-P2A-PdCO-WPRE
Plasmid#202198PurposeExpresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the optimized PdCO under control of minimal CamKIIa promotorDepositorInsertstChrimsonR, PdCO
UseAAVTagsEGFP and Rho1D4ExpressionMammalianPromoterCaMKIIα minimal promotor (0.4kb)Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sox17::CRY2-GFP
Plasmid#248078PurposeExpression of Sox17-driven CRY2–GFP fusion protein for optogenetic controlDepositorAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCavin1KDR-EGFP
Plasmid#187254PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 Flag GFP 4E-BP1 Rheb15 CAAX
Plasmid#112762Purposeexpress GFP-4EBP1-Rheb15(CAAX mutation)DepositorInsertFlag-GFP-4EBP1-Rheb15 (CAAX mutant) (EIF4EBP1 Human)
UseLentiviralTagsRheb15(CAAX mutant)MutationCAAX mutation to prevent lipid localizationAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn GFP-Cre
Plasmid#175381Purposeexpresses GFP-Cre under the control of a human synapsin promoterDepositorInsertGFP-Cre recombinase
UseAAVTagsCre is fused to GFP. GFP is fused to additional n…Promoterhuman synapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP
Plasmid#50457PurposeDouble floxed EGFP under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAG AAV CMV EGFP-HA
Plasmid#242963PurposeEdit AAV plasmid expressing EGFP-HA, control for plasmid 242962DepositorInsertEGFP
UseAAVTagsHAPromoterCMVAvailable SinceNov. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG Retro EGFP Neo
Plasmid#234464PurposeControl retroviral vector expressing Green Fluorescent Protein. Neomycin selection.DepositorInsertGreen Fluorescent Protein
UseRetroviralAvailable SinceMarch 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCYC1m_yeGFP
Plasmid#64389Purposeencodes yeast enhanced GFP under control of minimal pCYC1 promoterDepositorInsertyeast enhanced GFP
ExpressionYeastPromoterpCYC1Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pccGFPGpA
Plasmid#73651PurposeFluorescent reporter for transmembrane protein dimerization positive control.DepositorInsertglycophorin A
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAS_sfGFP150K
Plasmid#193313PurposepAS control plasmid for sfGFP expressionDepositorInsertsuper folder GFP
ExpressionMammalianMutation150K in sfGFPPromoterEF1Available SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pNOS::cogGFP (C132, JBEI-15898)
Plasmid#110145PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP G protein Gamma 3(K68A,K69A,F70A,F71A) in pcDNA3.1
Plasmid#42189DepositorInsertGamma 3(K68A,K69A,F70A,F71A) (Gng3 Mouse)
TagsEGFPExpressionMammalianMutationK68A,K69A,F70A,F71APromoterCMVAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-S37K/A44E (delta-NDP52)
Plasmid#208863PurposeStably express GFP-tagged NAP1 (delta-NDP52) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationS37K/A44E (disrupts NDP52 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-I11S/L12S (delta-FIP200)
Plasmid#208864PurposeStably express GFP-tagged NAP1 (delta-FIP200) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationI11S/L12S (disrupts FIP200 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-L226Q/L233Q (delta-TBK1)
Plasmid#208865PurposeStably express GFP-tagged NAP1 (delta-TBK1) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationL226Q/L233Q (disrupts TBK1 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pC4H::cogGFP (C44, JBEI-16338)
Plasmid#110144PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-E3-NSs-L*-EGFP-IRES-srIκBα-Smad7-SOCS1
Plasmid#242412PurposeSelf-amplifying RNA (saRNA) construct expresses dsRNA pathway inhibitors (E3, NSs, L*) and inflammatory signaling inhibitors, srIκBα, Smad7, and SOCS1.DepositorInsertsmScarlet3
IRES-E3-NSs-L*-EGFP
IRES-srIκBα-Smad7-SOCS1
UseMouse Targeting; Self-amplifying rnaExpressionMammalianAvailable SinceSept. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Human 3' HP1a AID GFP PuroR
Plasmid#127906PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Human HP1a GeneDepositorInsertHP1 (CBX5 Human, Mustard Weed)
UseDonor plasmidTagsGFP, AID, PuroRMutationInserting GFP AID 2A Puro into mouse 3' Hp1aAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF5-FRT-V5-DEST-GFP-Kif26b
Plasmid#102862PurposeExpresses GFP-Kif26b in mammalian cellsDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC-GFP-IRES-mCherry
Plasmid#231232PurposeMYC stability reporter construct (expressing c-myc 2) for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMYC (MYC Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MCRS1-GFP-IRES-mCherry
Plasmid#231231PurposeMCRS1 stability reporter construct for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMCRS1 (MCRS1 Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-d2eGFP-cxcr4
Plasmid#21967DepositorTypeEmpty backboneExpressionMammalianAvailable SinceNov. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-V5-eGFP_IDG-K
Plasmid#135265PurposeGateway destination clone of eGFP (as control) tagged with N-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertV5-eGFP
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianPromoterUbiquitinAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSG05-pGlnA-deGFP
Plasmid#102462PurposeExpresses deGFP fluorescent protein in E. coli. The expression is controlled by a pGlnA promoter.DepositorArticleInsertdeGFP
ExpressionBacterialPromoterpGlnAAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pP3-GFP
Plasmid#53436PurposeControls GFP expression from the P3 promoter cloned out of S. aureus RN4220 genomeDepositorInsertP3 promoter
UseSynthetic BiologyTagsnoneExpressionBacterialMutationnonePromoterP3Available SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FLEX-Gephyrin.FR-GFP-p2A-mRuby
Plasmid#245310PurposeExpression of synaptic GFP (no transcriptional control) and cytosolic mRubyDepositorInsertsGephyrin.FR-GFP-p2A-mRuby
Gephyrin.FR-GFP-p2A-mRuby
UseAAVExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL1-eGFP
Plasmid#242945PurposeEncodes a fragment of eGFP for generating dsRNA for use as a control in RNAi experimentsDepositorInserteGFP
UseRNAiAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG AAV CMV EGFP
Plasmid#242959PurposeAAV plasmid expressing EGFP, control for plasmid 242957DepositorInsertEGFP
UseAAVPromoterCMVAvailable SinceNov. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG Lenti CMV HA-EGFP Puro
Plasmid#236081PurposeLentiviral backbone expressing N-terminally HA tagged EGFP, control for empty backbone 236079DepositorInsertEGFP
UseLentiviralTagsHAPromoterCMVAvailable SinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG Lenti CMV EGFP-HA Puro
Plasmid#236082PurposeLentiviral backbone expressing C-terminally HA tagged EGFP, control for empty backbone 236080DepositorInsertEGFP
UseLentiviralTagsHAPromoterCMVAvailable SinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-EF1a-NLS-msfGFP-T2A-mCherry-NES> mPGK-PuroR
Plasmid#218916PurposeLentiviral construct expressing msfGFP and nuclear mCherry proteins.DepositorInsertEF1a-msfGFP-T2A-mCherry-NLS > mPGK-PuroR
UseLentiviralAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only