We narrowed to 8,515 results for: SET
-
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationTagsExpressionMammalianMutationPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ai66(RCRL-tdT) targeting vector
Plasmid#61578PurposeTarget a Dre and Cre-dependent tdTomato expression cassette to the mouse Rosa26 locusDepositorInsertCAG-RSR-LSL-tdTomato
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterCAGAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-Sox2-mStr
Plasmid#135617PurposeDonor vector for genomic targeting of a P2A-mStrawberry cassette to the 3' end of the mouse Sox2 locusDepositorInsertP2A-mStrawberry flanked by Sox2 homology arms (Sox2 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsP2A-mStrawberryExpressionMutationPromoterAvailable sinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiTagsExpressionMutationPromoter2x35SAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-GCaMP6M
Plasmid#137121PurposeIntersectional viral expression of GCaMP6M in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationRemoved RSET tagPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPC1000
Plasmid#174829PurposeLentiviral Repair-seq vector containing CRISPRi sgRNA and SaPE2 prime edit siteDepositorInsertsCRISPRi SpCas9 sgRNA cassette
PuroR-P2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationDetailed in manuscriptPromoterEF1a and mouse U6Available sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-Flag-h-SNRNP40
Plasmid#134254PurposeLentivector encoding Flag-tagged human SNRNP40DepositorInsertSNRP40 (SNRNP40 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterEF1aAvailable sinceMay 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Ef1a-Coff/Fon-GCaMP6F
Plasmid#137124PurposeIntersectional viral expression of GCaMP6F in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationRemoved RSET tagPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-ACTB
Plasmid#227320PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the ACTB locus. For actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB (Addgene #207748)DepositorInsertACTB Homology Arms flanking a Puro-2A-mStayGold Cassette (ACTB Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralTagsExpressionMutationPromoterEF1aAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDragon-p21
Plasmid#155016PurposeFor Flp-mediated cassette exchange. Expresses tdTomato in the presence of (r)tTA, switching to the cell cycle suppressor p21 in the presence of Cre and (r)tTA activityDepositorInsertCdkn1a (Cdkn1a Mouse)
UseMouse TargetingTagsExpressionMutationPromoterAvailable sinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-EF1a-hCas9IRESneo
Plasmid#67987PurposeMouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassetteDepositorInsertEF1a-hCas9IRESneopA
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
INS-GFP-CD19-EPT
Plasmid#210469PurposeDonor plasmid for knock-in GFP-CD19 into the human INS locusDepositorInsertINS homologous recombination arms with a GFP-CD19 and EF1alpha-drived puromycin-NLS-tdTomato selection cassette (INS Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-ultraID-LMNB1
Plasmid#207775PurposeDonor template for Blast-2A-ultraID insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-ultraID Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pROF346
Plasmid#155331PurposeBinary vector for expression of PULSE system (under the control of AtUbi10 promoter) controlling Venus-H2B. It constitutively expresses Cerulean-NLS and a plant selection cassette.DepositorInsertRB_KanR_Tnos-NLS-PIF6-E-PUbi10_Tnos-nCerulean-PUbi10_Tnos-NLS-VP16-PhyB-PUbi10_Tnos-EL222-NLS-SRDX-PUbi10_T35S-nVenus-POpto_LB
UseSynthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
BM00369
Plasmid#155338PurposeBinary vector for expression of PULSE system (under the control of CaMV35S promoter) controlling GUS. It constitutively expresses dsRed and a plant selection cassette.DepositorInsertRB_KanR_Tnos-NLS-PIF6-E-P35S_Tnos-dsRed-PUbi10_Tnos-NLS-VP16-PhyB-P35S_Tnos-EL222-NLS-SRDX-P35S_T35S-GUS-POpto_LB
UseSynthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBUN501
Plasmid#50582PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Bar resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationCas9D10A nickase, was derived from the zCas9 and …PromoterAtU6-26p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
Ai95(RCL-GCaMP6f) targeting vector
Plasmid#61579PurposeTarget a Cre-dependent GCaMP6-fast expression cassette to the mouse Rosa26 locusDepositorInsertCAG-LSL-GCaMP6-fast
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterCAGAvailable sinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-MAPRE1
Plasmid#207794PurposeDonor template to insert moxGFP-2A-Puro into the C-terminus of the MAPRE1 locus for growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 Addgene #207793DepositorInsertMAPRE1 Homology Arms flanking a moxGFP-Puro Cassette (MAPRE1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCC_03 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9-NLS-2A-Puro-WPRE
Plasmid#139088PurposeExpresses human codon-optimized xCas9 3.7 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9 3.7
UseCRISPR and LentiviralTagsExpressionMammalianMutationA262T, R324L,S409I, E480K, E543D, M694I, E1219VPromoterAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mScarlet-ACTB
Plasmid#207754PurposeDonor template for Puro-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mScarlet Cassette (ACTB Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
LoxP1-His-H2B-Cherry-2A (SO290)
Plasmid#99616PurposeTo clone gene of interest downstream of LoxP1-His-H2B-Cherry-2A cassetteDepositorInsert6xHis-H2B-Cherry
UseTagsT2AExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCC_06 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dCas9NG-NLS-VPR-2A-Puro-WPRE
Plasmid#139091PurposeExpresses human codon-optimized inactive SpCas9-NG fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdSpCas9-NG-VPR
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A, H840A, L1111R, D1135V,G1218R, E1219F, A1322…PromoterAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pv6_MECP2_MBD
Plasmid#179407PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of MECP2_MBDDepositorInsertMECP2_MBD (Mecp2 Mouse)
UseTagsAviTag and EGFPExpressionMammalianMutationPromoterCAGGSAvailable sinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon/Von GCaMP 6m
Plasmid#137165PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND Flp AND VcreDepositorInsert3x-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationRemoved RSET tagPromoterEf1aAvailable sinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCC_10 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dCas9NG-NLS-2A-Puro-WPRE
Plasmid#139095PurposeExpresses human codon-optimized inactive SpCas9-NG fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dSpCas9-NG
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A, H840A, L1111R, D1135V,G1218R, E1219F, A1322…PromoterAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-PolB-Hygro
Plasmid#176056PurposeEGFP fused to the N-terminus of PolB & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralTagsExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable sinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_PP7-tag
Plasmid#73078Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with PP7-tag on 5'-endDepositorInsertE2F7 (E2F7 Human)
UseTags5'-PP7-tag RNAExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-NLS-BirA-2A-mCherry-SV40pA-FKF
Plasmid#79889PurposeDonor cassette containing HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), mCherry protein and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertHA-tagged NLS-BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT
Plasmid#89890PurposeBAC donor construct containing 3XHA-tagged BirA, a ribosome skipping motif - 2A, Citrine reporter, polyadenyation signal, followed by FRT recombination sites flanking kanamycin selection cassette.DepositorInsertHA-BirA-2A-citrine
UseUnspecifiedTagsCitrineExpressionMutationPromoterAvailable sinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT1-His-H2B-Cherry-2A (IG156)
Plasmid#99622PurposeTo clone gene of interest downstream of FRT1-His-H2B-Cherry-2A cassetteDepositorInsertHis-H2B-Cherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mc4r->M71-IRES-tauGFP ACNF TV
Plasmid#105072PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-333 of Mc4r and an IRES-tauGFP followed by ACNF cassetteDepositorInsertMc4r->M71-IRES-tauGFP-ACNF (Mc4r Mouse)
UseMouse TargetingTagsExpressionMutationPromoterAvailable sinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_2ntmut
Plasmid#73074Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns, 2…PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Af1521(K35E/Y145R)-myc
Plasmid#196237PurposeAf1521(K35E/Y145R) macrodomain with a myc tag fused to the C terminus & a hygromycin resistance cassetteDepositorInsertAf1521(K35E/Y145R) encoding a C-terminal myc tag
UseLentiviralTagsmyc tagExpressionMammalianMutationamino acid 35 lysine is replaced with glutamic ac…PromoterEF1AAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-Zfr-P2A-HA-luciferase
Plasmid#223188PurposePlasmid containing the Zfr/Firefly luciferase cassette. Translation of luciferase is controlled by splicing modulation of the Zfr by risdiplam.DepositorInsertluciferase (LOC116160065 firefly)
UseAAVTagsHA and engineered P2AExpressionMutationPromoterTNNT2Available sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC175_HBA1reg(synEPOR)
Plasmid#232413PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank H+C15BA1 cassette. HAs are ~400bp each.DepositorInsertTruncated Erythropoietin Receptor (EPOR Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA1
Plasmid#232623PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA2
Plasmid#232624PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA3
Plasmid#232625PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-KO-Puro-TP53
Plasmid#227319PurposeDonor template for 2A-Puro insertion into the N-terminus of the TP53 locus. For selectable p53 knock-out. To be co-transfected with sgRNA plasmid px330-TP53 (Addgene #227318)DepositorInsertTP53 Homology Arms flanking a 2A-Puro Cassette (TP53 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Blast-ARL13B
Plasmid#227278PurposeDonor template for mStayGold-EFS-Blast insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorInsertARL13B Homology Arms flanking a mStayGold-EFS-Blast Cassette (ARL13B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro-CEP192
Plasmid#227290PurposeDonor template for mStayGold-EFS-Puro insertion into the C-term of CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold-EFS-Puro Cassette (CEP192 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA324
Plasmid#215953PurposeFragmid fragment: (guide cassette) guide expression; reverse orientation; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0[EnAs]; sgCD46_v4[EnAs]; DR_v1[EnAs]; sgCD47_v2[EnAs]; DR_v2[EnAs]; sgCD55_v4[EnAs];DR_v3[EnAs];sgCD81_v4[EnAs]}
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EhT
Plasmid#215546PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived hygromycin-NLS-tdTomato selection cassette (B2M Human)
UseCRISPRTagsExpressionMutationThe second base of the first intron of B2M (From …PromoterAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only