170,204 results
-
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4552 x6NFATRE (NFAT) Ben DsRed-Express2 in TUPV1
Plasmid#244201PurposeExpression of a DsRed-Express2 reporter under an NFAT-responsive promoterDepositorInsertNFAT-responsive promoter (6 NFAT binding sites + YB_TATA), dsRed-Express2 reporter
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.MaCPNS2
Plasmid#185137Purposenon-standard AAV2 rep-AAV-MaCPNS2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-MaCPNS2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) - Hyperactive AID - T7 RNA Polymerase -UGI - T2A - tdTamato
Plasmid#138610PurposeExpress TRACE editor together with a tdTomato reporter in pcDNA3.1(+) backboneDepositorInsertsHyperactive AID
T7 RNA Polymerase
tdTomato
ExpressionMammalianAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHel3
Plasmid#102961PurposeE.coli/H.Pylori shuttle vectorDepositorTypeEmpty backboneUseShuttle vectorAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT646 human L1 ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro
Plasmid#213026PurposeExpresses full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBRC1
Plasmid#183064PurposeBase editing plasmid for Pseudomonas chlororaphisDepositorInserteSpCas9ppD10A
UseCRISPR and Synthetic BiologyAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pME-zFUCCI (JDW 1464)
Plasmid#242558PurposeGateway middle entry clone containing zebrafish FUCCI reporter; For visualizing cell cycle state.DepositorInsertmCerulean-zGeminin(1-100) P2A mCherry-zCdt1(1-190)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRBC-sfGFP wild type
Plasmid#174075PurposePlasmid with p15a origin of replication expressing codon optimized superfolder GFP with C-terminal His6 tag, under T7 promoterDepositorInsertSuperfolder GFP
TagsHis-6ExpressionBacterialPromoterT7Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF2531
Plasmid#142954PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-TetOn-mCherry-OAZ1_FS-YFP
Plasmid#232356PurposeMammalian expression of dox-inducible polyamine sensor (polyamine levels = YFP/Cherry)DepositorInsertOAZ1 derived polyamine sensing module (OAZ1 Human)
UseLentiviralTagseYFP and mCherryExpressionMammalianPromoterTRE3GAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Myc-14-3-3ζ
Plasmid#48798Purposeexpresses human myc-14-3-3ζ in mammalian cellsDepositorAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pK18msB
Plasmid#177839PurposePlasmid for gene replacement using kanamycin/sucrose selection/counterselection. Derived from pK18mobsacB but reduced in size.DepositorTypeEmpty backboneUseBacterial gene replacementAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Kir2.1-T2A-tdTomato
Plasmid#60598PurposeExpresses Kir2.1-T2A-tdTomatoDepositorAvailable SinceNov. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pScaf
Plasmid#111401PurposePhagemid for producing DNA origami scaffolds, derived from pUC18 and M13mp18DepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Utr230-EGFP-3XNLS
Plasmid#58466PurposeExpresses a nuclear-targeted actin filament reporter, consisting of the first 230 amino acids of human utrophin, on a CMV promoterDepositorInsertsTagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
3XFlag-pA-Tn5-Fl
Plasmid#124601PurposeExpresses protein A and Tn5 Transposase fusion protein in bacterial cellsDepositorInsertProtein A and hyperactive Tn5 transposase (Tnp) fusion protein
TagsProtein A and Tn5 transposase fusion protein with…ExpressionBacterialPromoterT7Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCherry-SEpHluorin
Plasmid#32001DepositorInsertmCherry
TagsSuperecliptic pHluorinExpressionMammalianAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSL1777 (pEffector)
Plasmid#160731PurposeEffector expression for V. cholerae CAST system, encodes all protein and RNA components. Entry vector encodes non-targeting crRNA, with BsaI sites for spacer cloning. pCDF backbone.DepositorInsertVchCAST proteins and crRNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Matrix-roGFP
Plasmid#49437PurposeExpresses thiol redox-sensitive ratiometric sensor roGFP in the mitochondrial matrix of mammalian cellsDepositorInsertMatrix-roGFP2
UseAdenoviralTagsCytochrome c oxidase subunit IV mitochondrial tar…ExpressionMammalianMutationC48S, Q80R, S147C, and Q204C in Clontech's G…PromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only