We narrowed to 6,070 results for: nls
-
Plasmid#223422PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA was driven by separate ZmUbi1 promoter; Hygromycin for plants select.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT51
Plasmid#223423PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for dicot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-LbCas12a-RRV-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT52
Plasmid#223424PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GA_AIO-TetOn_mScarlet_Up-Tandem
Plasmid#229793PurposeBxb1-GA donor plasmid with upstream tandem syntax for all-in-one doxycycline-inducible mScarlet expressionDepositorInsertTRE-mScarlet; rtTA-T2A-mTagBFP2
UseSynthetic BiologyTagsNLSExpressionMammalianMutationPromoterTRE and CAGAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sga-Cas9
Plasmid#227005PurposeMammalian expression of Nuclease active S. gallolyticus Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sin-Cas9
Plasmid#227006PurposeMammalian expression of Nuclease active S. iniae Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Spa-Cas9
Plasmid#227007PurposeMammalian expression of Nuclease active S. parasanguinis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sub-Cas9
Plasmid#227008PurposeMammalian expression of Nuclease active S. uberis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTripZ-Tet-ON mCherry
Plasmid#187262PurposeDoxycyclin inducible expression of mCherryDepositorInsertmCherry-NLS
UseLentiviralTagsmCherryExpressionMutationPromoterCMVAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-Cas9-FCPF
Plasmid#220132PurposeExpresses Cas9-FCPF in E.coliDepositorInsertCas9-FCPF (cas9 S. pyogenes)
UseTagsHis and NLSExpressionBacterialMutationPromoterT7Available sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-KRAB-2A-mTurquoise
Plasmid#225690PurposeLentiviral expression of rTetR(SE) fused to ZNF10 KRAB and mTurquoise-NLSDepositorInsertrTetR-ZNF10 KRAB
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3668
Plasmid#215243PurposeTU for the expression of mAID (N-tag): AcrIIA4 w/o NLS protein Codon optimized for N. benthamiana expression under the regulation of the 35S promoter and TNOS terminatorDepositorInsertP35S:mAID:AcrIIA4:TNOS
UseSynthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only