We narrowed to 6,501 results for: nls
-
Plasmid#216399PurposeExpresses 6xHis-tagged DBD of Efg1DepositorInsertEfg1-DBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 2-181 and 357-554Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Intersectin SH3 domain A
Plasmid#47396DepositorInsertIntersectin SH3 domain A
TagsGSTExpressionBacterialMutationSH3 domain APromotertacAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Intersectin SH3 domain B
Plasmid#47397DepositorInsertIntersectin SH3 domain B
TagsGSTExpressionBacterialMutationSH3 domain BPromotertacAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Intersectin SH3 domain C
Plasmid#47398DepositorInsertIntersectin SH3 domain C
TagsGSTExpressionBacterialMutationSH3 domain CPromotertacAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Intersectin SH3 domain E
Plasmid#47400DepositorInsertIntersectin SH3 domain E
TagsGSTExpressionBacterialMutationSH3 domain EPromotertacAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pLVX-TetOn-puro-ICP4
Plasmid#250611PurposeMammalian lentiviral vector for the inducible (TetOn) expression of codon-optimized HSV-1 ICP4DepositorInsertICP4
UseLentiviralExpressionMammalianMutationCodon-optimized for Homo sapiensPromoterTRE3GS promoterAvailable sinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EZ-L498
Plasmid#131771PurposePPGK1_FUSN_Citrine _PixE_TCYC1DepositorInsertPPGK1_FUSN_Citrine _PixE_TCYC1
UseIntegration into his3 locusExpressionYeastPromoterPGKAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJ411 FUS 1-163 Y24xF
Plasmid#127196PurposeProtein expression for affinity purificationDepositorInsertFUS 1-163 Y24xF (FUS Human)
TagshexahistidineExpressionBacterialMutationY24xF: Y6F, Y14F, Y17F, Y25F, Y33F, Y38F, Y41F, Y…Available sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_del321-343
Plasmid#98676PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with a deletion of AA 321-343DepositorAvailable sinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-HA-NEK7 K64M
Plasmid#75143PurposeExpresses N-terminal HA-tagged NEK7 (with a K64M substitution; kinase dead) in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNIMA (never in mitosis gene a)-related expressed kinase 7 (Nek7 Mouse)
TagsHAExpressionMammalianMutationLys 64 mutated to Met; kinase inactive and F236L …PromoterCMVAvailable sinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
REKAR76
Plasmid#223262PurposeEKAREN4 modified to be a Red-FRET sensor using miRFP720 and miRFP670nano3 (in that order; AKA REKAR76)DepositorInsertREKAR-76
TagsmiRFP670nano3 and miRFP720ExpressionBacterial and MammalianMutationmiRFP720 - EKAREN4 - miRFP670nano3PromoterhEF-1aAvailable sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDIV490
Plasmid#177698PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast species.DepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRHR2p (Debaryomyces hansenii ) and TDH3p (Candida…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDIV488
Plasmid#177696PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast speciesDepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterTDH3p (Candida lusitaniae) and TEF1p (Ashbya goss…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hnRNPA2_LC_nocharge
Plasmid#139118Purposeexpress hnRNPA2 LC with no charged residuesDepositorInserthnRNPA2 (HNRNPA2B1 Human)
ExpressionBacterialMutationall charged residues are changed to S/Q except fo…Available sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
RV-Cag-Dio-mTdt
Plasmid#87665Purposeretroviral vector encoding cre dependent expression of membrane TdtomatoDepositorInsertMem-Tdtomato
UseRetroviralPromoterCAGAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
RV-Syn-Dio-mTdt
Plasmid#87667Purposeretroviral vector encoding cre dependent expression of membrane TdtomatoDepositorInsertMem-Tdtomato
UseRetroviralTagspalmitylationPromoterSynapsinAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES- mCE(K294A)
Plasmid#82464PurposeExpresses myc tag and catalytic inactive form of mRNA capping enzyme with N terminal Nuclear export signal (NES)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNES mRNA capping enzyme (Rngtt HIV, Mouse)
TagsmycExpressionMammalianMutationK294APromoterCMVAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc-mCE(K294A)
Plasmid#82461PurposeExpression of myc epitope and catalytic inactive form of murine mRNA Capping Enzyme (K294A) in mammalian cellsDepositorInsertmCE (K294A) (Rngtt Mouse)
TagsmycExpressionMammalianMutationLysine 294 changed to AlaninePromoterCMVAvailable sinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only