We narrowed to 4,936 results for: AAT
-
Plasmid#174604Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes Aatf, irgq and cpne1DepositorInsertpalmitoyl-GFP C-term fusion LLO190 and minigenes of 3 neoantigens from MC38 tumor in genes Aatf irgq cpne1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
OA-1045D
Plasmid#125006PurposeExpresses gRNAs targeting hedgehog and winglessDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Vps25-g1)-PGKpuroBFP-W
Plasmid#105033PurposeLentiviral gRNA plasmid targeting mouse Vps25 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
KNTC1 A11.4 gRNA
Plasmid#90732Purpose3rd generation lentiviral gRNA plasmid targeting human KNTC1DepositorInsertKNTC1 (Guide Designation A11.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_2
Plasmid#86322PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ATF7IPi1
Plasmid#59614PurposeExpression of shRNA against human ATF7IPDepositorAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV-sgE1TSS-short-3'box
Plasmid#92165PurposesgRNA expression vector for Evx1as RNA tethering assayDepositorInsertEvx1as short isoform
UseCRISPRPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.3b
Plasmid#125560PurposeFor expression of the genetically encoded dopamine sensor dLight1.3bDepositorHas ServiceAAV1, AAV5, and AAV9InsertdLight1.3b
UseAAVTagsFlag tagExpressionMammalianPromoterCAGAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P CISD2_2
Plasmid#160776PurposeSuppress CISD2DepositorInsertshCISD2_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-scFv-GCN4-sfGFP-GB1-NLS-iLID-dWPRE
Plasmid#121966PurposeExpresses fusion of single chain variable fragment recognizing SunTag, fluorescent protein sfGFP, and iLID which upon light activation binds to sspB.DepositorInsertscFv-GCN4
UseLentiviralTagssuperfold GFP-GB1-NLS-iLIDExpressionMammalianPromoterSFFVAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-SorLA-v1
Plasmid#154892PurposeExpresses SorLA fused to Venus fragment 1 (v1) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-dLight1.3b
Plasmid#135762PurposeFor expression of the genetically encoded dopamine sensor dLight1.3bDepositorHas ServiceAAV9InsertdLight1.3b
UseAAVTagsFlag tagExpressionMammalianPromoterSynapsinAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-dLight1.2
Plasmid#111068PurposeTo generate Adeno-Associated viruses for expression of dLight1.2 under synapsin promoterDepositorHas ServiceAAV1 and AAV5InsertdLight1.2
UseAAVTagsFlag tagAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-HNRNPA1C-mCh-Cry2WT
Plasmid#101226PurposehnRNPA1(186-320) fused to mCh-Cry2WTDepositorAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRluc-LC3G120A
Plasmid#105003PurposeMammalian expression of Rluc-LC3G120A. Can be used for measuring autophagic flux.DepositorInsertLC3B (Map1lc3b Rat)
UseLuciferaseTagsRluc with C124A substitutionExpressionMammalianMutationGlycine 120 mutated to alanine, prevents lipidati…Available SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-SorLA-v2
Plasmid#154900PurposeExpresses SorLA fused to Venus fragment 2 (v2) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.1
Plasmid#111067PurposeTo generate Adeno-Associated viruses for expression of dLight1.1 under CAG promoterDepositorHas ServiceAAV1 and AAV5InsertdLight1.1
UseAAVTagsFlag tagAvailable SinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-dLight1.1
Plasmid#111066PurposeTo generate Adeno-Associated viruses for expression of dLight1.1 under synapsin promoterDepositorHas ServiceAAV1InsertdLight1.1
UseAAVTagsFlag tagAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Strep/HA-UBE2J1
Plasmid#124669PurposeExpresses UBE2J1 with N-terminal Strep-HA tag in mammalian cellsDepositorAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut AP-1+C/EBP
Plasmid#61292Purposedrives luciferase from mouse IL-6 promoter with mutations in both AP-1 & C/EBP sitesDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated both AP-1 binding site from TGAGTCT to TG…PromoterIL-6 promoter with mutant AP-1 and C/EBP binding …Available SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
L2_lacZgRNA-Cas9-CsA
Plasmid#136138PurposePlasmid to accept gRNA target with SapI, lacZ blue-white screening. Contains Cas9 and HygR.DepositorInsertp5-35Sx2:HygR p5-MpU6:lacZgRNA p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Chr7_Centromere-Targeting_gRNA
Plasmid#195129Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFPDepositorInsertChr7 gRNA
ExpressionMammalianAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-pSFFV-TAF15N-mCherry-sspB
Plasmid#122436PurposeExpresses fusion of disordered protein TAF15(1-208), fluorescent protein mCherry, and SspB which upon light activation binds to iLID.DepositorInsertTAF15 (TAF15 Human)
UseLentiviralTagsmCherry and sspBExpressionMammalianMutationContains only amino acids 1-208PromoterSFFVAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7820 pHR (hU6-crPURI-EFS-PuroR-WPRE)
Plasmid#214883PurposeLentiviral vector encoding RfxCas13d targeting PURI guide arrayDepositorInserthU6-crPURI-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCM2_wt_eGFP
Plasmid#208876PurposeExpress eGFP-CCM2 in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001148608)
Plasmid#77539Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-mClover3-MAP4-MTBD
Plasmid#171498PurposeT7 promotor drives in vitro transcription of mClover3-tagged mouse MAP4-Microtubule Binding Domain mRNADepositorAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-HNRNPK-ts3
Plasmid#174252PurposeHNRNPK knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-VGAT-WPRE-pA
Plasmid#39320DepositorInsertSlc32a1 (Slc32a1 Mouse)
UseAAV; RAvailable SinceOct. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGPT2_5
Plasmid#163455Purposelentiviral vector expressing Cas9 and an sgRNA targeting GPT2DepositorInsertsgRNA 5 targeting GPT2 (GPT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.2
Plasmid#111069PurposeTo generate Adeno-Associated viruses for expression of dLight1.1 under CAG promoterDepositorHas ServiceAAV1InsertdLight1.2
UseAAVTagsFlag tagAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-TAF15N-miRFP670-Cry2WT
Plasmid#122440PurposeExpresses disordered protein TAF15(1-208) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertTAF15 (TAF15 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationContains only amino acids 1-208PromoterSFFVAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E638K
Plasmid#139327PurposePlasmid expressing a sgRNA to introduce BRCA1 E638K using base editingDepositorInsertsgRNA to insert BRCA1 E638K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSico shSMYD3-C human
Plasmid#85654Purposeexpression of shRNA targeting human SMYD3DepositorInsertshRNA targeting 3'UTR of SMYD3 (SMYD3 Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only