We narrowed to 9,474 results for: control
-
Plasmid#161960PurposeMammalian expression of non-targeted inactivated control version of genetically encoded biosensor for (pseudo)hypohalous acids and their derivativesDepositorInsertHypocrates
ExpressionMammalianMutationchanged Cysteine 355 to SerinePromoterCMV, SP6Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131003Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsKv2.1-HAPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)
Plasmid#47868PurposeThis plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter.DepositorInsertsNmCas9
U6pr-tracrRNA
UseCRISPRTagsHA and NLSExpressionMammalianPromoterEF1a and U6Available SinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-ATOH1-T2A-PuroR
Plasmid#162342PurposeLentiviral expression of ATOH1 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJFRC-13XLexAoP-FRT-STOP-FRT-myrGFP-2A-KDR::Pest
Plasmid#217515PurposeEncodes a LexAoP controlled and Flp dependent conditional trangene of bicistronic myrGFP and KD RecombinaseDepositorInsert13XLexAoP-FRT-STOP-FRT-myrGFP-2A-KDR::Pest
ExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBait-YY1
Plasmid#165147PurposeBait plasmid for PROBER with YY1-binding site (positive control)DepositorInsert3X YY1 motif
UseUnspecifiedAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE
Plasmid#130991PurposeAAV vector to drive the expression of soma-targeted ChRmine-mScarlet under the control of CamKIIa promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsmScarlet-Kv2.1PromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJM656
Plasmid#53086PurposeA non-Phosphatidylserine binding mutant form of Lactadherin(sGFP::LactC1C2mut) to be used as a controlDepositorInsertLactaherin (Mfge8 Mouse)
TagsGFP (w/ introns) and signal sequenceExpressionWormMutationdeleted native signal sequence, deleted C-termina…Promoterhsp-16.41Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-RasAR(R89L)-NES
Plasmid#205568PurposeRasAR negative-control mutant plasmid. Targeted to cytosol.DepositorInsertRasAR(R89L)-NES (RAF1 Synthetic, Human)
TagsNuclear export signal (NES)ExpressionMammalianMutationArg 89 mutated to Leu in Raf1 RBD region.PromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.Thbs1-HA.SV40(polyA)
Plasmid#195552PurposeExpresses Thbs1 under control of short GFAP promoterDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC13-hygro
Plasmid#231988PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a_ASCL1_P2A_Hygro_Barcode
Plasmid#120427PurposeBarcoded lentiviral vector to express ASCL1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp16-HF
Plasmid#157725Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp16 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
EF1a_FLI1_P2A_Hygro_Barcode
Plasmid#120437PurposeBarcoded lentiviral vector to express FLI1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
FUGW-PK-hLC3∆G
Plasmid#61461PurposeExpress pHluorin-mKate2-hLC3∆G (PK-hLC3∆G), a negative control for pHluorin-mKate2-hLC3 (PK-hLC3), in mammalian cells for monitoring autophagy, based on FUGW (3rd gen lentiviral plasmid)DepositorAvailable SinceFeb. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123T/T159C)-mCherry
Plasmid#35510PurposeAAV expression of Ef1a-driven, cre-dependent, hChR2 variant for ultrafast optogenetic control.DepositorInserthChR2
UseAAVTagsmCherryExpressionMammalianMutationE123T and T159CPromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC49-puro
Plasmid#231989PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hOCT3/4-shp53-F + mCherry-2A-puro
Plasmid#74947PurposeDosage control and tracing of reprogramming episomesDepositorInsertOct3/4 (POU5F1 Human)
ExpressionMammalianAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV BARK D110A p2A mCherry
Plasmid#117690PurposeCMV-iBARK(D110A)-p2A-mCherry: Negative control mammalian expression vector for Gaq silencingDepositorInsertBARKrgs D110A peptide
TagsHA / FLAGExpressionMammalianMutationD110AAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEcNucC
Plasmid#214050PurposeBacterial expression plasmid for E. coli MS 115-1 NucC, a cA3-responsive nuclease known to cause abortive infection; used as a positive control in the Haliangium ochraceum type III CRISPR-Cas systemDepositorInsertEcNucC
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-WPRE
Plasmid#130990PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsmScarletPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Caprola_on-mEGFP
Plasmid#194694PurposeCMV driven expression of the consitutively active calcium recorder positive control Caprola_on fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertCaprola_on-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Caprola_off-mEGFP
Plasmid#194695PurposeCMV driven expression of the inactive calcium recorder negative control Caprola_off fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertCaprola_off-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_CRX_P2A_Hygro_Barcode
Plasmid#120433PurposeBarcoded lentiviral vector to express CRX in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shScramble-hsynapsin-EGFP
Plasmid#220795Purposecontrol shRNA plasmid with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET30a-His6-LOXCATmut
Plasmid#140085PurposeA control for His6-LOXCAT where LOX is catalytically dead (mutations H265A and R268A)DepositorInsertA fusion of lactate oxidase from A. viridans and catalase from E. coli
TagsHis6ExpressionBacterialMutationMutation in H265A and R268A in LOX (used original…PromoterT7Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_GATA4_P2A_Hygro_Barcode
Plasmid#120444PurposeBarcoded lentiviral vector to express GATA4 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUSL001T:pTRE3G-dCas9-2xKRAB-p2a-tdTomato
Plasmid#209298PurposeA lentiviral vector with tetracycline-inducible system to control expression of S. aureus dCas9 (with tdTomato) to silencing specific genes due to interference with gene transcription machinery.DepositorInsertsdCas9
tdTomato
UseLentiviralExpressionMammalianPromotertetracycline-inducible promoter (TRE3G)Available SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_Ikkalpha(S176E,S180E)-P2A-Hygro_Barcode
Plasmid#170236PurposeBarcoded lentiviral vector to express Ikkalpha (S176E, S180E) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-eYFP-WPRE
Plasmid#130988PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagseYFPPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_scrambled_gRNA_2
Plasmid#196628PurposeScrambled control 2 for STING knock-out in murine cells.DepositorInsertmSTING scrambled gRNA 2
UseCRISPR and LentiviralMutationWTAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry
Plasmid#35512PurposeAAV expression of CaMKIIa-driven hChR2 variant for ultrafast optogenetic control.DepositorHas ServiceAAV2InserthChR2
UseAAVTagsmCherryExpressionMammalianMutationE123T and T159CPromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLX307-VHL(Y98H)-3F-BirA
Plasmid#220148PurposeExpresses VHL(Y98H)-BirA as a control for VHL substrate identification by E-STUBDepositorInsertvon Hippel-Lindau tumor suppressor (VHL Human)
UseLentiviralTags3F-BirAExpressionMammalianMutationchanged tyrosine 98 to histidine; codon optimizedPromoterEF-1aAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EGFP
Plasmid#166140PurposeEGFP expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEX-PK-hLC3∆G
Plasmid#61459PurposeExpress pHluorin-mKate2-hLC3∆G (PK-hLC3∆G), a negative control for pHluorin-mKate2-hLC3 (PK-hLC3), in mammalian cells for monitoring autophagyDepositorAvailable SinceFeb. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B3
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS1
Plasmid#170852PurposeAAV backbone for transgene expression in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SOX2_P2A_Hygro_Barcode
Plasmid#120480PurposeBarcoded lentiviral vector to express SOX2 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only