We narrowed to 11,153 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#81217PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch12 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch12_62418577-gRNA-for
Plasmid#81216PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch12 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBHM2673
Plasmid#241720PurposeIntegration of DNA into Cryptococcus neoformans Safe Haven 1 locus, contains BSD marker for selection on blasticidin SDepositorTypeEmpty backboneExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfB8383
Plasmid#126917PurposePlasmid containing integration cassette at XI-3 integration site in Saccharomyces cerevisiae for overexpression of tHMG1DepositorInserttHMG1
ExpressionYeastAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF709
Plasmid#121891PurposeEF1a-ZIKV-protease-mTagBFP2DepositorInsertsUseLentiviralPromoterEF1a core promoterAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -126
Plasmid#50924PurposeU6 driven sgRNA targeting Sox17 -126 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_ABE7.10_St1Cas9_LMD9
Plasmid#136660PurposeExpresses ABE St1Cas9 LMD9 in mammalian cells along with its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
ABE7.10
UseCRISPR and Synthetic BiologyTagsSV40 NLS and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SlugABE-NNG
Plasmid#214356PurposeExpresses SlugABE-NNGDepositorInsertSlugABE-NNG
UseAAVExpressionMammalianMutationQ782R/S888R/L906R/N984S/E1012K/K1016IAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGinB-8X(GGS)-dCas9-FLAG-NLS_SpecR
Plasmid#81206PurposeCMV promoter driving expression of GinB catalytic domain fused with linker to dCas9 in the order shown. Has a FLAG and NLS tag on the c-terminus. Spec resistanceDepositorInsertpGinB-8X(GGS)-dCas9-FLAG-NLS
ExpressionMammalianPromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTW194b63
Plasmid#136930PurposeDirected evolution of SpCas10DepositorInsertnpuC-gIII(C)
UseCRISPRExpressionBacterialMutationnoneAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR-GFP
Plasmid#100009PurposeExpresses Cas9-GFP and sgRNA in Nannochloropsis oceanica, contains hygromycin resistance cassette, for integration into geneomeDepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-GFPPromoterRibi promoterAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLD037-pCMV-APOBEC-Cas9(D10A)-rXRCC1
Plasmid#165444PurposeExpresses ACX, rXRCC1 in mammalian cellsDepositorInsertAPOBEC-nCas9-rXRCC1 (Apobec1 Streptococcus pyogenes, Synthetic, Rat)
ExpressionMammalianAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
BB3cN_pGAP_23*_pLAT1_Cas9
Plasmid#104906PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on NTCDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceFeb. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SaCas9
Plasmid#102853PurposeA single-chain light-controllable dSaCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (GRIN2B Human, S. aureus, Synthetic)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoter;Available SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS468-pLK.O1-NmeSgRNA/DTS13-Telomere
Plasmid#85714PurposeTelomere-targeting Nme sgRNA under U6 promoterDepositorInserttelomere sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-UGCG-KO
Plasmid#80010PurposegRNA to knock out expression of UGCG gene. The product of this gene catalyzes the first step in synthesis of glycosphingolipids.DepositorInsertUGCG (UGCG Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM28 gRNA (BRDN0001145369)
Plasmid#76141Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM28 gRNA (BRDN0001146162)
Plasmid#76142Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only