We narrowed to 13,951 results for: CRISPR-Cas9
-
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHS73_10xHis_MBP_TEV_SpRY-Cas9_2xNLS
Plasmid#244835PurposeBacterial expression of SpRY Cas9 with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpRY Cas9
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialMutationA61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS72_10xHis_MBP_TEV_SpG-Cas9_2xNLS
Plasmid#244834PurposeBacterial expression of SpG Cas9 with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpG Cas9
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialMutationD1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-tdTomato-VPR
Plasmid#232632PurposeVPR activation domain coupled to catalytically inactive dCas9 for localization; contains tdTomato for labeling and as a spacerDepositorInsertdCas9-tdTomato-VPR
UseCRISPRTagsNLSExpressionMammalianMutationnonePromoterCMVAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
Plasmid#42335PurposeA human codon-optimized SpCas9 nickase and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTagsHAExpressionMammalianMutationD10A nickase-converting mutationAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9(1.1)-2×sgRNA (empty, donor)
Plasmid#80768PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSD_SpCas9MT3-NLS-3xHA-NLS-SaCas9WT-2xNLS
Plasmid#107322PurposeExpresses SpCas9 (R1335K) fused to SaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 (R1335K) is fused to SaCas9PromoterCMV IE93Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_SpCas9MT2-NLS-3xHA-NLS-SaCas9WT-2xNLS
Plasmid#107321PurposeExpresses SpCas9 (R1333S) fused to SaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 (R1333S) is fused to SaCas9PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-T2A-GFP
Plasmid#53190Purpose3rd generation transfer vector. Co-expresses human optimized S. pyogenes Cas9 and GFPDepositorInserthumanized Cas9 T2A GFP
UseCRISPR and LentiviralTagsFlagExpressionMammalianPromoterhUbCAvailable SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-dCas9-T2A-GFP
Plasmid#53191PurposeCo-expresses human optimized S. pyogenes dCas9 and GFPDepositorInserthumanized dead Cas9 T2A GFP
UseCRISPR and LentiviralTagsFlagExpressionMammalianMutationD10A and H840APromoterhUbCAvailable SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-VP64-dCas9-VP64_Blast
Plasmid#192650Purpose3rd generation lenti vector encoding VP64-dCas9-VP64 with 2A Blast resistance markerDepositorInsertVP64-dCas9-VP64
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGG>nls-hCas9-nls-GFP
Plasmid#99141PurposeCas9-GFP fusion protein under the regulation of chicken beta-actin promoterDepositorInsertCas9-GFP
UseCRISPRTagsGFPPromoterChicken beta actin (CAG)Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Eef1a-1955/-1>nls::Cas9::nls
Plasmid#59987PurposeEef1a (EF1alpha) promoter driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Eef1a (EF1alpha) -1955/-1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-VP64-dCas9-p300_Blast
Plasmid#192654Purpose3rd generation lenti vector encoding VP64-dCas9-p300 with 2A Blast resistance markerDepositorInsertVP64-dCas9-p300
UseCRISPR and LentiviralExpressionMammalianMutationD10A; H840A in Cas9PromoterEF1aAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9+sgRNA expression vector precursor
Plasmid#171798PurposePICASSO: Library expression vector precursor for paired dCas9+sgRNA expressionDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterpLtetOAvailable SinceAug. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mesp-1916/-1>nls::Cas9::nls
Plasmid#59988PurposeMesp driver driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Mesp -1916/-1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_TP73
Plasmid#214691PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG1guide_RUBY_EggCas9
Plasmid#225983PurposeTo make mutant alleles of AtAGAMOUS1 gene in Arabidopsis thaliana. The transgenics can be selected by red color appearance of plantsDepositorInsertGuide RNA against AtAGAMOUS1
UseCRISPRExpressionPlantPromoter35s promoter to Drive RUBY and DD45p to drive Cas9Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_NC_chr1
Plasmid#214690PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pxCas9CR4
Plasmid#111656PurposePCas9CR4 with the xCas9 mutations allowing NG PAM sitesDepositorInsertTetR and xCas9
UseSynthetic BiologyTagsssrAExpressionBacterialMutationxCas9 mutationsAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr1
Plasmid#214682PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr2
Plasmid#214683PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 2 (negative control)DepositorInsertdgRNA_Chr2
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_TP73
Plasmid#214685PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_BFP_hs_NC_chr1
Plasmid#214686PurposeLentiviral expression vector for an inducible Cas9-P2A-BFP with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_BFP_hs_TP73
Plasmid#214687PurposeLentiviral expression vector for an inducible Cas9-P2A-BFP with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
NLS-dCas9-trCIB1
Plasmid#64119PurposePhotoactivatable transcription system. Expression of genomic anchor probe, containing dCas9 and CIB1DepositorInsertdCas9-trCIB1 fusion
TagsHA and NLSExpressionMammalianMutationdCas9 (D10A H840A, catalytically inactive), trCIB…PromoterCMVAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCas9-T2A-BFP
Plasmid#78547PurposeCas9 protein with BFPDepositorInsertT2A-BFP
UseLentiviralExpressionMammalianPromoterIn frame with Cas9Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-sadCas9-VP64
Plasmid#115790PurposeAn AAV vector expressing S. aureus dCas9 fused to VP64.DepositorInsertSa-dCas9
UseAAVTagsNLS and NLS-VP64ExpressionMammalianPromoterCMVAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
TET1cd-dCas9 (D12)
Plasmid#239488PurposeEncodes a CRISPR/dCas9-based fusion protein designed for targeted DNA demethylation.DepositorInsertRPS5A-TET1cd-XTEN80-NLS-dCas9-2xNLS-P2A-BFP
UseCRISPRExpressionPlantAvailable SinceFeb. 17, 2026AvailabilityAcademic Institutions and Nonprofits only