We narrowed to 16,633 results for: puromycin
-
Plasmid#218139PurposeLentiviral vector expressing evolved degron SD56 fused to eGFP with mCherry control.DepositorInsertSD56-eGFP-IRES2-mCherry
UseLentiviralAvailable SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLIN2-V5-APEX2
Plasmid#170573PurposeA C-terminal APEX2 fusion to the mouse perilipin-2 protein PLIN2DepositorAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aalb_743
Plasmid#176676PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029743) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-STX17ΔNTD
Plasmid#89941PurposeExpresses syntaxin17 lacking N-terminal domain tagged with GFP in mammalian cellsDepositorInserthuman syntaxin17 lacking N-terminal domain (STX17 Human)
UseRetroviralTagsGFPMutationdeleted amino acids 1-161Available SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX307 Luciferase
Plasmid#117734PurposeOpen reading frame vector encoding LuciferaseDepositorInsertfirefly luciferase
UseLentiviralTagsV5ExpressionMammalianPromoterEF1aAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC
Plasmid#64874Purposelentiviral vector with Flag, HA tagsDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsFlag and HAExpressionMammalianAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti TurboRFP BlastR
Plasmid#102343PurposeLentiviral expression of cytoplasmic TurboRFP with Blasticidin selection in cells including neuronsDepositorInsertTurboRFP
UseLentiviralTagsN/APromoterCMV immediate earlyAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Empty
Plasmid#91980PurposeEmpty backboneDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ABE8e SpG Puro
Plasmid#235044PurposeAdenosine base editor 8e* with SpG nicking Cas9 makes A > G editsDepositorInsertABE8e, nCas9
UseCRISPR and LentiviralTagsP2A-PuroRPromoterEF1a coreAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ppst93-ANME1BS MCR-NG
Plasmid#192772PurposeExpresses NG-tagged ANME1BS MCR in Methanococcus maripaludisDepositorInsertMethyl coenzyme M reductase
UseSynthetic Biology; Heterologous expression in met…TagsFlag-Strep2Available SinceDec. 7, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCEP-Puro-TetOn-L1RP-ORF1_K3AK4A_Halo-GFPai
Plasmid#202568PurposeExpresses an endogenous-like L1RP LINE-1 element with a C-terminal HaloTag on the ORF1 protein with the K3A and K4A mutations and a GFP retrotransposition reporter (GFP-AI) in the 3' UTRDepositorInsertLINE-1
TagsGFP-AI retrotransposition reporter and HaloTag7 o…ExpressionMammalianMutationChanged ORF1p Lysine 3 to Alanine, ORF1p Lysine 4…Available SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-DelGFP
Plasmid#133302PurposeEGFP reporter was removed in the TLCV2 vector so it could be used for inducible gene CRISPR knockout in cell lines with an eGFP reporter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMH-SFB
Plasmid#99391PurposeGateway-compatible mammalian expression destination vector for creating SFB N-terminal fusions (S protein tag, Flag tag, Streptavidin binding peptide)DepositorTypeEmpty backboneTagsSFB (S protein-FLAG-Streptavidin binding peptide)ExpressionMammalianAvailable SinceSept. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-mitoLbNOX-Flag
Plasmid#234985PurposeExpresses mitochondrial LbNOX in human cell linesDepositorInsertmito-LbNOX
UseLentiviralTagsFlagExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-hTERT-HA
Plasmid#1772DepositorAvailable SinceJune 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aaeg_774
Plasmid#176673PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017774) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV: Flag-Antares_SV40:PuroR
Plasmid#183049PurposeExpresses FLAG-tagged Antares in mammalian cells.DepositorInsertAntares BRET reporter
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_SBP-EGFP-GPI
Plasmid#65298Purposesynchronize trafficking of EGFP-GPI from the ER (RUSH system)DepositorInsertGPI anchor
UseLentiviralTagsEGFP and IL-2 Signal Sequence and Streptavidin Bi…PromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shRen.713
Plasmid#186712PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Non-targeting control shRNA (shRen.713).DepositorInsertshRen.713
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only