We narrowed to 7,491 results for: RAP
-
Plasmid#172728PurposeEncodes Part 1b of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1a Spacer
Plasmid#172727PurposeEncodes Part 1a of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1-5 DO
Plasmid#172726PurposeEncodes a sfGFP dropout expression cassette in place of Parts 1-5 to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B Q116P G120
Plasmid#129290PurposeExpresses GFP-tagged deconjugation-resistant LC3B in mammalian cellsDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsGFPExpressionMammalianMutationChanged Glutamine 116 to Proline. Deleted amino a…PromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
im:7163548_L (OZ571)
Plasmid#35211DepositorInsertZinc finger array targeting im:7163548 (im:7163548 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
zgc:162148_L (OZ579)
Plasmid#35219DepositorInsertZinc finger array targeting zgc:162148 (micu1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
im:7163548_R (OZ572)
Plasmid#35212DepositorInsertZinc finger array targeting im:7163548 (im:7163548 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLY095-EFS-ERBB2 HER2-Blast-WPRE
Plasmid#192196PurposeLenti-HER2-OE-BlastDepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
RB1-TP53-LRG-GFP
Plasmid#225876PurposeGuides targeting TP53 and RB1DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1A-MYC-IRES-luc
Plasmid#129775PurposeTransposon based vector that expresses human MYC followed by IRES and firefly luciferaseDepositorAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFC34K LgBiT TK-Neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229770PurposeHuman Col4A5 tagged at C-terminal with LgBiT to be used with C-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC36K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229769PurposeHuman Col4A3 tagged at C-terminal with SmBiT to be used with C-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX401-INK4A
Plasmid#121919PurposeDoxycycline-inducible expression of p16-INK4A product of CDKN2ADepositorAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD63-pHluorin
Plasmid#130901PurposeExpression of CD63-pHluorin for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD63-pHluorin (CD63 Aequorea victoria, Human)
TagspHluorinExpressionMammalianMutationpHluorin inserted between Gln-36 and Leu-37 in ex…PromoterCMVAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20 MEF2C
Plasmid#89717PurposeLentiviral gene expression vector for doxycycline inducible MEF2C expressionDepositorAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD81-pHluorin
Plasmid#130903PurposeExpression of CD81-pHluorin for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD81-pHluorin (CD81 aequorea victoria, Human)
TagspHluorinExpressionMammalianMutationpHluorin inserted between Leu-49 and Gly-50 in ex…PromoterCMVAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 S HexaPro
Plasmid#154754PurposeMammalian expression vector for expression of the SARS-CoV-2 spike HexaPro variantDepositorInsertSpike (HexaPro variant) (S Severe acute respiratory syndrome coronavirus 2)
Tags2X Strep-Tag II, 8X His tag, and HRV 3C cleavage …ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceJuly 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-Sport6-CD63-pHuji
Plasmid#130902PurposeExpression of CD63-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD63-pHuji (CD63 Human, synthetic)
TagspHujiExpressionMammalianMutationpHuji inserted between Gln-36 and Leu-37 in extra…PromoterCMVAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUW-VenusFlag-hCD44
Plasmid#211824PurposeExpress CD44 in mammalian cellsDepositorInsertCD44 (CD44 Human)
UseLentiviralTagsN-Terminal Venus and Flag tagsExpressionMammalianMutationisoform corresponds to UniProt ID P16070-1 with a…Available SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
MLRV2: NF-kb-SMAD-DBE-P53-AP1
Plasmid#124536PurposeMultiplex luciferase reporter vector, with luciferase reporters for the pathways NFKB, SMAD, FOXO, P53 and AP1DepositorInserts5 copies of the NF-kb DNA binding motif
7xSMAD_RE::FLuc
3xDBE_BE::Renilla (FOXO)
2xP53_RE::NLuc
6xAP-1_RE::GrRenilla
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable SinceJune 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY080b_AAV_EFS-4D5-CD8-28BBz (HER2 CAR)
Plasmid#192190PurposeHER2 CAR AAV vector PRODH2 KI (pLY080b)DepositorInsertHER2 CAR AAV vector PRODH2 KI (pLY080b) (ERBB2 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 CAG rtTA3 TauP301L 2N4R-EGFP
Plasmid#132393PurposeExchange cassette containing inducible TauP301L 2N4R-EGFP fusion, CAG-driven rtTA3, Puromycin resistance marker, targets AAVS1 siteDepositorInserthuman TauP301L 2N4R-EGFP (MAPT Human, Synthetic)
UseCRISPR and Cre/LoxTagsEGFPExpressionMammalianMutationProline 301 to Leucine (P301L)PromoterTREtightAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 CAG rtTA3 TauWT 2N4R-EGFP
Plasmid#132389PurposeExchange cassette containing inducible TauWT 2N4R-EGFP fusion, CAG-driven rtTA3, Puromycin resistance marker, targets AAVS1 siteDepositorInserthuman TauWT 2N4R-EGFP (MAPT Human, Synthetic)
UseCRISPR and Cre/LoxTagsEGFPExpressionMammalianPromoterTREtightAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCag SE (Self-excising) FlpO-2A-Cre EV
Plasmid#130986Purposeepisomal expression of FlpO and Cre recombinases, self excisingDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianMutationprotamine intron added to FlpO to prevent bacteri…PromoterCMV/Chick β-actin (CAG)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD81-pHuji
Plasmid#130904PurposeExpression of CD81-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD81-pHuji (CD81 Human, Synthetic)
TagspHujiExpressionMammalianMutationpHuji inserted between Leu-49 and Gly-50 in extra…PromoterCMVAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-TEAD4-YBD
Plasmid#166450PurposeExpresses fusion of mCherry and TEAD4-YAP binding domainDepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFN33K LgBiT TK-neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229768PurposeHuman Col4A5 tagged at N-terminal with LgBiT to be used with N-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFN35K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229767PurposeHuman Col4A3 tagged at N-terminal with SmBiT to be used with N-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 3 chain (COL4A3) (COL4A3 Human)
UseLuciferaseTagsSmBiTMutationSee Depositor CommentsAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only