We narrowed to 24,790 results for: Spr
-
Plasmid#179448PurposeDonor vector to knock in mClover3 N-terminal to human PER2 geneDepositorInsertmClover3
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-RAB7A
Plasmid#227298PurposeDonor template for mStayGold insertion into the N-terminus of the RAB7A locus. For endosome visualization. To be co-transfected with sgRNA plasmid px330-RAB7A (Addgene #227297)DepositorInsertRAB7A Homology Arms flanking a mStayGold Tag (RAB7A Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
BE3-P2A-EGFP (pJUL977)
Plasmid#123612PurposeCAG promoter expression plasmid for rAPOBEC1-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP.DepositorInsertBE3-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR_UCOE-EF1a-dCas9-XTEN80-KRAB(Kox1)-IRES-mCherry
Plasmid#188769PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterEF1aAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-CMV-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188772PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterCMVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-hHDAC4-tagBFP-PGK-Blasticidin
Plasmid#187954PurposeFKBP12 (F36V mutant) degron-tagged dCas9-hHDAC4 fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-hHDAC4-tagBFP
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-Cas9-T2A-mCherry
Plasmid#135012PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianPromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgTSC2
Plasmid#128098PurposeCRISPR gRNA against human TSC2 with Cas9 from S. pyogenes and 2A-EGFPDepositorAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4F2-mCherry
Plasmid#73421PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4F2.DepositorInsertPromoter 4F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
SPACE-VRQR (pRZ5137)
Plasmid#140245PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_VRQR-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_VRQR
ExpressionMammalianMutationV82G in TadA*, VRQR mutations in SpCas9, D10A in …PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CLTC
Plasmid#227313PurposeDonor template for mStayGold insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold Tag (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
KAT2A sgRNA2
Plasmid#138186Purpose3rd generation lentiviral gRNA plasmid targeting human KAT2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT2A sgRNA1
Plasmid#138185Purpose3rd generation lentiviral gRNA plasmid targeting human KAT2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EFS-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188771PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterEFSAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:VPR:Tnos (GB1826)
Plasmid#160623PurposeTU for the constitutive expression of dCas9 fused to VPR (VP64-p65-Rta) activation domainsDepositorInsertP35S:dCas9:VPR-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pblu-AAVS1-Cas9-p300-M2rtTA-AAVS1
Plasmid#112261PurposeDonor plasmid with a Cas9-p300 expression cassette, a M2rtTA expression cassette, a T2A-puro selection cassette, and two gRNA recognition sequences at both ends of the whole insertion DNA fragment.DepositorInsertspCas9-p300 (EP300 Human, Synthetic)
ExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
SPACE-ΔUGI (pRZ1836)
Plasmid#140243PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9-pmCDA1(R187W)-P2A-EGFPDepositorInsertSPACE-ΔUGI
ExpressionMammalianMutationV82G in TadA*, D10A in Cas9, R187W in pmCDA1PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
eA3A-BE3 (pRZ206)
Plasmid#131315PurposeCAG promoter expression plasmid for hA3A(N57G)-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthA3A(N57G)-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-mClover3-CD4-bla
Plasmid#179441PurposeDonor vector to knock in mClover3 C-terminal to human CRY1 geneDepositorInsertmClover3
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJSC281 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC2 FRET variant
Plasmid#101230PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC2 FRET variantDepositorInsertSpCas9 variant C80S/C574S/E60C/D273C/N692A/M694A/Q695A/H698A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, E60C, D273C, N692A, M694A, Q695A and…PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-ultraID-LMNB1
Plasmid#207775PurposeDonor template for Blast-2A-ultraID insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-ultraID Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330-Elf5 gRNA
Plasmid#128836PurposegRNA for targeting mouse Elf5 loci using CRISPR-cas techniqueDepositorInsertmElf5 gRNA (Elf5 Mouse)
UseCRISPRAvailable SinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE4889
Plasmid#88905PurposeExpresses FnCpf1 crRNA and inactive/dead, humanized FnCpf1 nucleaseDepositorInsertsFn crRNA
hFnCpf1(D917A)
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
CGBE1-VRQR (pBM1192)
Plasmid#140254PurposeCMV promoter expression plasmid for UNG(E.coli)-rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInserteUNG-BE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-Halo-CD4-bla
Plasmid#179445PurposeDonor vector to knock in Halotag C-terminal to human CRY1 geneDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCC_03 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9-NLS-2A-Puro-WPRE
Plasmid#139088PurposeExpresses human codon-optimized xCas9 3.7 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9 3.7
UseCRISPR and LentiviralExpressionMammalianMutationA262T, R324L,S409I, E480K, E543D, M694I, E1219VAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-MAPRE1
Plasmid#207794PurposeDonor template to insert moxGFP-2A-Puro into the C-terminus of the MAPRE1 locus for growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 Addgene #207793DepositorInsertMAPRE1 Homology Arms flanking a moxGFP-Puro Cassette (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-mScarlet-ACTB
Plasmid#207754PurposeDonor template for Puro-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mScarlet Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_1-pTRNA-scf 2.1 (GB2603)
Plasmid#160568PurposetRNA and scaffold 2.1 scRNA aptamer Ms2 for the assembly of GBoligomers for a single position of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_1-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
BPK3274 - human expression plasmid for eSpCas9(1.1)-HF1
Plasmid#101177PurposeHuman expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant: CMV-T7-hSpCas9-eSpCas9(1.1)-HF1(N497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-eSpCas9(1.1)-HF1(N497A/R661A/Q695A/K848A/Q926A/K1003A/R1060A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN497A/R661A/Q695A/K848A/Q926A/K1003A/R1060APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRGEN-CMV-VPR-WT CjCas9 V-WT
Plasmid#169914PurposeExpression of VPR-WT CjCas9 fusion protein to induce orthogonal genes knock out and activation.DepositorInsertCjCas9
UseCRISPRTags2xSV40NLS, SV40NLS-HA, and VPR (VP64-p65-Rta)ExpressionMammalianPromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
H517 SONIC HRASV12 donor
Plasmid#138177PurposeCRISPR SONIC: HRAS G12V donor plasmidDepositorInsertHRASV12 (HRAS Human)
UseNhej donorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-TGFB2
Plasmid#185556PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting TGFB2DepositorInsertTGFB2 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJSC282 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variant
Plasmid#101231PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variantDepositorInsertSpCas9 variant C80S/C574S/S701C/S960C/N692A/M694A/Q695A/H698A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S701C, S960C, N692A, M694A, Q695A an…PromoterT7Available SinceNov. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-MFAP2
Plasmid#185555PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting MFAP2DepositorInsertMFAP2 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-Halo-CD4-bla
Plasmid#179451PurposeDonor vector to knock in Halotag C-terminal to human PER2 geneDepositorAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-Luciferase-hvTK-bla
Plasmid#179444PurposeDonor vector to knock in firefly Luciferase C-terminal to human CRY1 geneDepositorInsertLuciferase
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_UCOE-SFFV-dCas9-XTEN80-KRAB(Kox1)-IRES-mCherry
Plasmid#188770PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3F2-mCherry
Plasmid#73418PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3F2.DepositorInsertPromoter 3F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
Plasmid#157951PurposeLentiviral expression of HBG site 1 sgRNADepositorInsertLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR1
Plasmid#176244PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only