We narrowed to 24,008 results for: Sis
-
Plasmid#136594PurposeExpresses the mechanosensitive channel OSCA1.8 in mammalian cellsDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pMADM-beta
Plasmid#36891DepositorInsertsBeta-Geo
thymidine kinase
ExpressionMammalianPromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-Z34
Plasmid#120062PurposeTemplate for C-terminal PCR tagging of mammalian genes (Zeocin selection) with 3xFLAGDepositorInsert3xFLAG
UsePcr templateTags3xFLAGPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAROTENE5X
Plasmid#208816PurposeEncodes bacterial crtEBIY operon under the control of synthetic promoter responsive to JUB1-derived artificial transcription factor in bacterial cellDepositorInsertFive copies of JUB1 binding site within the synthetic promoter
UseSynthetic BiologyExpressionBacterialPromoterJUB1 TF-responsive promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFYF1328 EGFP Site#3
Plasmid#47513Purposehuman gRNA expression vector targeting EGFPDepositorInsertgRNA-EGFP site 3
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET-mF(3230)A3
Plasmid#168016PurposeExpresses MBP-F(3230)A3-6xHis in bacterial cellsDepositorInsertMBP-F(3230)A3-6xHis
TagsHisx6 and maltose binding proteinExpressionBacterialAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRL c-Myc 3'UTR
Plasmid#14806DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRU54
Plasmid#167680PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-hIFITM3
Plasmid#58461PurposeExpresses human IFITM3 with an N-terminal myc tag in mammalian cells.DepositorAvailable SinceSept. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
WZLneo-C/EBPα
Plasmid#34567DepositorAvailable SinceMarch 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET26_MraYaa
Plasmid#100166Purposerecombinant expression of target protein as an MBP-His tag fusionat the N-terminus of target proteinDepositorInsertmraY (phospho-MurNAc-pentapeptide translocase)
TagsMBP-HisExpressionBacterialPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBT44c
Plasmid#138511PurposeP2DepositorInsertinteinC-dSpCas9-UGI
UseSynthetic BiologyAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV-Cx35-Halo-C-end
Plasmid#71512PurposeMammalian expression plasmid encoding perch Cx35 with a C-terminal HaloTag.DepositorInsertConnexin 35
TagsHaloTagExpressionMammalianAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS84 (U6p::GGACAGTCCTGCCGAGGTGG)
Plasmid#193852PurposeEncodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGGDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;cldn5bP1Egfp
Plasmid#90158Purposecontains cldn5b specific gene promoter driving expression of eGFPDepositorAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human DGCR8-1
Plasmid#14769DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
PhyB-mCherry-Tom7
Plasmid#66571PurposeConstitutively express mitochondrial localized PhyB in Saccharomyces cerevisiaeDepositorInsertPhyB (PHYB Mustard Weed)
TagsTom7 and mCherryExpressionYeastMutationPhyB portion contains aa's 1-908PromoterpADH1Available SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-VEGFR2-225
Plasmid#21306DepositorInsertVEGFR2 promoter (KDR Human)
UseLuciferaseAvailable SinceMay 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-trAtCCD7-OsD27(pYL726 )
Plasmid#178285PurposeCo-Expresses OsD27 and trAtCCD7 in E. coli. pCDFDuet-1 carrying D27 from Oryza sativa and N-terminus 31 amino-acid truncated CCD7 from ArabidopsisDepositorInsertsOsD27
trAtCCD7
ExpressionBacterialPromoterT7Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Psicheck2 PTPRN2 full length 3'UTR
Plasmid#26994DepositorInsertPTPRN2 Full length 3' UTR (PTPRN2 Human)
UseLuciferaseTagsRenilla LuciferaseExpressionMammalianAvailable SinceJan. 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P33
Plasmid#120018PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with FLAGDepositorInsertFLAG
UsePcr templateTagsFLAGPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-Z26
Plasmid#120069PurposeTemplate for C-terminal PCR tagging of mammalian genes (Zeocin selection) with mAID-CloverDepositorInsertmAID-Clover
UsePcr templateTagsmAID-CloverPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pMaCTag-Z22
Plasmid#120065PurposeTemplate for C-terminal PCR tagging of mammalian genes (Zeocin selection) with SNAPDepositorInsertSNAP
UsePcr templateTagsSNAPPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Mouse 3' Hp1a AID GFP PuroR
Plasmid#127897PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Mouse Hp1a GeneDepositorInsertHp1a (Cbx5 Mustard Weed, Mouse)
UseDonor plasmidTagsGFP, AID, PuroRMutationInserting GFP AID 2A Puro into mouse 3' Hp1aAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P12
Plasmid#120023PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with mScarletDepositorInsertmScarlet
UsePcr templateTagsmScarletPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCK019
Plasmid#105378PurposeSynthetic biologyDepositorInsertpromotor EXP7 (At1g12560; 750bp)
UseSynthetic BiologyMutationBsaI/ BpiI restriction sites removedAvailable SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1A-Dm-miR-92a
Plasmid#22767DepositorInsertmicro RNA 92a (mir-92a primary transcript, Fly)
UseDrosophila expressionAvailable SinceJan. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUC18-H1 RNAi
Plasmid#87355PurposeRNAi expression vector based on H1 promoter and pUC18 vector backboneDepositorInsertH1 RNA Promoter from U87MG glioma cells
UseRNAi; Shrna expression vectorExpressionMammalianPromoterH1 RNAAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-eA3AmaxNG-BlastR
Plasmid#152999PurposeC-to-T base editor, NG PAMDepositorInserteA3A-nSpCas9 NG-UGI-UGI
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P06
Plasmid#120017PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with sfGFPDepositorInsertsfGFP
UsePcr templateTagssfGFPPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
SHC003BSD-DelGFP
Plasmid#133301PurposeEGFP reporter was removed and the selection marker was modified as blasticidin in the construct of SHC003. This construct could be used for expression of a gene by lentiviral approach.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWPI-TFDP1
Plasmid#114299PurposeConstitutive expression of the TFDP1 proteinDepositorInsertTFDP1 (TFDP1 Human)
UseLentiviralAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJW1354
Plasmid#69490PurposeGly-Ser-4xGly linker-degron-TEV-3xFLAG with 40 bp nhr-25 homology armsDepositorInsertGSGGGG spacer-Degron-TEV protease site-3x FLAG epitope
UseCRISPR; Template to generate cassettes for -media…Available SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
TagRFP-T-Rabenosyn-5
Plasmid#37537DepositorAvailable SinceJan. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRU293
Plasmid#167688PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS-H2B-EYFP
Plasmid#53746Purposecontains fusion of human histone H2B to EYFP in pCS2+ vector.DepositorAvailable SinceJuly 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Ufm1 WT
Plasmid#133865PurposeExpression of human wild type UFM1DepositorAvailable SinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
p7133 pHAGE-P-CMVt-N-HA-GAW-PRKAR2B
Plasmid#100160PurposeExpresses PRKAR2BDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-TERF1
Plasmid#222542PurposePiggyBac transposon plasmid for doxycycline inducible expression of TERF1DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only