We narrowed to 2,443 results for: CLU
-
Plasmid#179544Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT domain (aa 1287-1664) driven by AF4 promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 HAT domain (aa 1287-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninWT
Plasmid#229702PurposeLentiviral expression of iRFP670-alpha-cateninWT in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninΔβH
Plasmid#229705PurposeTransient expression of GFP-alpha-catenin-delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+
Plasmid#229697PurposeTransient expression of GFP-alpha-cateninA+ in mammalian cells; enhanced actin bindingDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+ΔβH
Plasmid#229704PurposeTransient expression of GFP-alpha-cateninA+deltabetaH in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-FBXL5-SKP1
Plasmid#226620PurposeCo-expression of FBXL5-SKP1 complex in E.coliDepositorTagsGB1ExpressionBacterialMutationAmino acids 1-198 was deleted, and 420-596 was re…PromoterT7Available SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK27Sumo_His-SUMO-nsp14-nsp10 fusion (SARS-CoV-2)
Plasmid#169160PurposeTo express nsp14-nsp10 fusion protein in E. coliDepositorInsert14His-SUMO-nsp14-GGSGGS-nsp10 (ORF1ab Synthetic, SARS-CoV-2)
Tags14His-SUMO and Fusion protein of SARS-CoV-2 nsp14…ExpressionBacterialMutationCodon optimised for E. coliPromoterT5Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-CARzeta-GFP
Plasmid#89344Purpose2nd generation lentiviral vector which expresses DNA-CAR receptor fused to GFPDepositorAvailable SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta F-Box
Plasmid#197452PurposeThe plasmid expresses F-box deleted version of Myc-tagged FBW7 human isoform 1. Used for mammalian overexpression of FBW7alpha delta-F-Box and detection by western blotting.DepositorAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+
Plasmid#229703PurposeLentiviral expression of iRFP670-alpha-cateninA+ in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
t1-405
Plasmid#166127PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1Head (1-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP HAT
Plasmid#179547Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_7
Plasmid#60293PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SK
Plasmid#136577PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, Klf4DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET11a_3xFlag-nsp10 (SARS-CoV-2)
Plasmid#169157PurposeTo express SARS-CoV-2 nsp10 in E. coliDepositorInsert3xFlag-nsp5CS[VRLQ]-nsp10 (ORF1ab Synthetic, SARS-CoV-2)
Tags3xFlag and nsp5CS[VRLQ]: predicted nsp5 protease …ExpressionBacterialMutationCodon optimised for E. coliPromoterT7Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_9
Plasmid#60258PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertNKX6-1 enhancer (NKX6-1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_25
Plasmid#60305PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169164PurposeBaculoviral transfer vector to co-express SARS-CoV-2 nsp14 and nsp10 in insect cellsDepositorInsertnsp14/nsp10-6His-3xFlag (ORF1ab Synthetic, SARS-CoV-2)
Tags6His-3xFlag (nsp10 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_9
Plasmid#60295PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1401
Plasmid#29198PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP reporterDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KS
Plasmid#136617PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_29
Plasmid#60309PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_10
Plasmid#60259PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertRFX6 enhancer (RFX6 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_25
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertROCK1 enhancer (ROCK1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_31
Plasmid#60310PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_21
Plasmid#60296PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_19
Plasmid#60302PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1538
Plasmid#29261PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving a lacZ reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn T21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
Plasmid#225591PurposeAAV transgene plasmid with hSyn promoter for expression of catalytically dead TRIM21 RING(I18R+M72E)-F8.2(S54L+T127A) anti-tau degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
UseAAVTagsmCherryExpressionMammalianPromoterhSynAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninΔβH
Plasmid#229706PurposeLentiviral expression of iRFP670-alpha-catenin-delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-CTNNA1(α-catenin CRISPR KO)
Plasmid#229708PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technologyDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninV-
Plasmid#229696PurposeTransient expression of GFP-alpha-cateninV- in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationL344PPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-SOX2-3xHA-P2A-tagBFP
Plasmid#163701PurposeDox-inducible SOX2-3xHA HDR knock-in cassette into the AAVS1 locus with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertsUseAAV and CRISPRTags3x-HA and P2A-tagBFPExpressionMammalianPromoterCAG and TRE3GAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorExpressionWormMutationD387A, E490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-203-GFP
Plasmid#205183PurposeExpresses chimeric rat CENP-O with mouse CENP-O middle region including central RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O middle regi…PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta WD40 (-2 to 7)
Plasmid#197454PurposeThe plasmid expresses delta WD40 deleted version of Myc-tagged FBW7 human isoform 1. WD40 propellars 2 to 7 are deleted. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 Delta-WD40 propeller (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW& dimerization domain deleted.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 WD40 (All deleted)
Plasmid#197455PurposeThe plasmid expresses delta WD40 deleted version of Myc-tagged FBW7 human isoform 1. WD40 All are deleted. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW& dimerization domain deleted.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 PHD-HAT
Plasmid#179545Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP PHD-HAT
Plasmid#179548Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBIG1b_nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169162PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp10 in insect cellsDepositorInsertnsp10-6His-3xFlag (ORF1ab Synthetic, SARS-CoV-2)
Tags6His-3xFlagExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp14 (SARS-CoV-2)
Plasmid#169163PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp14 in insect cellsDepositorInsert3xFlag-6His-nsp14 (ORF1ab Synthetic, SARS-CoV-2)
Tags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Aro--
Plasmid#169716PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Aro-
Plasmid#169715PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Aro+
Plasmid#169717PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids. PHE and TYR amino acids shuffled to optimize mixing.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Patchy
Plasmid#169719PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_26
Plasmid#60306PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only