We narrowed to 14,358 results for: cas9 genes
-
Plasmid#183423PurposeFlpON knock-in vector with FLAG-SpCas9 expressionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only
-
SK-YFP-SPNM-B
Plasmid#48661PurposeBacterial SP and NM repression YFP reporter: protospacer BDepositorInsertSP/NM prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
Hulk-ubi-lacZ-to-Green
Plasmid#108641Purposeubiquitous promoter followed by a lacZ to GFP lineage tracing line. Cryst:venusGFPDepositorInsertubi-lacZ-to-GFP
Available SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-TetR-Rad18UBD
Plasmid#119010PurposeMammalian expression of a fusion protein of single chain Tet repressor with the human Rad18 Ubiquitin binding domain and BFP expressionDepositorInsertTetR
ExpressionMammalianPromoterCAGAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Trex2-bpA
Plasmid#86984PurposeExpression of mouse Trex2DepositorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG1
Plasmid#90276Purpose(also pMST621-BB3_gpyrG1_cas9) CRISPR/Cas9 plasmid with gRNA for pyrG1, Cas9DepositorInsertgRNA (pyrg1)
UseA. nigerExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-TetR-RNF169UBD
Plasmid#119011PurposeMammalian expression of a fusion protein of single chain Tet repressor with the human RNF169 Ubiquitin binding domain and BFP expressionDepositorInsertTetR
ExpressionMammalianPromoterCAGAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-B
Plasmid#48663PurposeBacterial TD repression YFP reporter: protospacer BDepositorInsertTD prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-A
Plasmid#48665PurposeBacterial ST1 repression YFP reporter: protospacer ADepositorInsertST1 prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGMF6
Plasmid#242208Purpose35Sp::eGFP:35St cassette in L1 vector backbone. Expresses a nuclear localized eGFP protein for transient plant transformation.DepositorInsertLevel1 35Sp::eGFP:35St
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only