We narrowed to 1,219 results for: cas12
-
Plasmid#217343PurposecrRNA targeting CD55DepositorAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pRDB_054
Plasmid#216096PurposeAll-in-one, knockout, delivers Cas12a & gRNADepositorInsertCas12a [EnAs]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH29 (crCD81-1)
Plasmid#217344PurposecrRNA targeting CD81DepositorAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA008
Plasmid#216003PurposeFragmid fragment: (Cas protein) preferred over wildtype Cas12aDepositorHas ServiceCloning Grade DNAInsertCas12a_v1.1 [EnAs]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO
Plasmid#155048PurposeLentiviral backbone for cloning and expressing U6 driven hybrid guide (hg)RNAs with BfuAI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 HDV (GB1444)
Plasmid#160576PurposeHepatitis Delta Virus ribozyme signal for the assembly of gRNA expression cassettes.DepositorInsertHDV
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTarget-entry
Plasmid#220996PurposeProkaryotic expression of mRFP and GFP. Target sequences are inserted in place of the RFP gene through AatII/KpnI restriction ligationDepositorInsertmRFP, GFP
ExpressionBacterialAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTB105
Plasmid#236778PurposeBackbone for cloning sgRNAs to be used with CRISPR Cas9 cytosine base editor. Expressed from the 18S rRNA SSU locus in Leishmania. Contains puromycin selection marker.DepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA181
Plasmid#216024PurposeFragmid fragment: (Cas protein) unmodified AsCas12a; not preferredDepositorHas ServiceCloning Grade DNAInsertCas12a_v1.1 [As]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_816
Plasmid#216098PurposeCRISPRa, EF1a-driven ALFA-dCas12a-VP64 (Cas only)DepositorInsertCas12a [EnAs]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9FnCpf1GG
Plasmid#131013PurposeBackbone plasmid for generating CRISPR arrays for composite array utilized by SpCas9 and FnCas12a using CRATES. Contains a GFP-dropout cassette and two direct repeats.DepositorInsertsdirect repeat of SpCas9
GFP expression cassette
direct repeat of FnCas12a
UseCRISPRExpressionBacterialAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BEACON2
Plasmid#171698PurposeExpresses BEACON2 in mammalian cellsDepositorInsertBEACON2
UseCRISPRExpressionMammalianMutationhAPOBEC3A_W98Y/W104A/Y130FPromoterCMVAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-pT
Plasmid#138108PurposeGolden Gate recipient and Gateway entry vector; assembly of 4 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi
Plasmid#138106PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTarget-RFP-GFP operon
Plasmid#192279PurposeRFP GFP fusion protein expressed under a constitutive promoterDepositorInsertRFP GFP
ExpressionBacterialPromoterPlacIqAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BEACON1
Plasmid#171697PurposeExpresses BEACON1 in mammalian cellsDepositorInsertBEACON1
UseCRISPRExpressionMammalianMutationhAPOBEC3A_W104A/Y132DPromoterCMVAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ143-ZmUbi
Plasmid#138107PurposeGolden Gate recipient and Gateway entry vector; assembly of 3 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ165
Plasmid#109327PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zCas9-NLS driven by egg cell-specific promoterDepositorInsertzCas9
UseCRISPR; Gateway compatible zcas9 entry cloneTags3x FLAG, NLS and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterPromoter EC1.2 enhancer fused to EC1.1 promoterAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMini-CAAGs::RFP-DR48
Plasmid#132640PurposeFluorescent reporter to quantify elicitation of the strand annealing mediated repair pathwayDepositorInsertmRFP
ExpressionMammalianMutationContains a 92bp insertion interrupting the open …PromoterChicken B-actinAvailable SinceNov. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTarget: Ptaq-RFP_PlacIq-GFP
Plasmid#192280PurposeRFP expressed under constitutive promoter Ptaq and GFP expressed under constitutive promoter PlaciqDepositorInsertsRFP
GFP
ExpressionBacterialPromoterPlacIq and PtaqAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-As
Plasmid#209026PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-Lb
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBFC0687
Plasmid#186692PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_2xBsaI_NT (Guide Stuffer) gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry-intergenic-As
Plasmid#209037PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBFC0694
Plasmid#186693PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_lacZ_α_1 gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_lacZ_α_1 gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA52_Lenti.puro.U6_modified DR
Plasmid#196723PurposeFor cloning pairs of AsCas12a guides with two DRs that are as different as possible.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only