We narrowed to 2,909 results for: rela
-
Plasmid#41680DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; CFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-570-YFP-571CT
Plasmid#41679DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; YFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-565-CFP-566CT
Plasmid#41678DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; CFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30Xa-SBL1(160E,NoCys)
Plasmid#66875PurposeExpresses a cysteine-free version of pET30Xa-SBL1(160E) (4Cys to Ser) with N-term HistagDepositorInsertsoybean lipoxygenase-1 (S160E) with all Cys to Ser mutations
TagsHistagExpressionBacterialMutationS160E; changed 4 (all) cysteines to serinePromoterT7lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
PA-mCherry-miniSOG-H2B-C-10
Plasmid#57789PurposeLocalization: Nucleus/Histones, Excitation: 448 / 473, Emission: 500 / 528DepositorInsertH2B (H2BC11 Human)
TagsPA-mCherry-miniSOGExpressionMammalianMutationD26G and V119I in H2BPromoterCMVAvailable SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a S620T
Plasmid#53059PurposeExpresses alpha subunit of S620T hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Serine 620 to ThreoninePromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1(+)mGAT1CFP45
Plasmid#41676DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; 45 C-terminal-…PromoterCMVAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1YFP45
Plasmid#41675DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; 45 C-terminal-…PromoterCMVAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1Xpress-AbrR683AN795A-HisC
Plasmid#32510DepositorAvailable SinceFeb. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET28aAviHisCD72aCTLD
Plasmid#129065Purposegeneration of biotinylated mouse CD72a CTLD protein using bacteriaDepositorInsertCD72a (Cd72 Mouse)
ExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
M3-PSCFP2
Plasmid#114185Purposestudying clustering of M3 receptors by superresolution microscopy (PALM)DepositorInsertMuscarin acetylcholine receptor 3 (CHRM3 Human)
Tags3xHA and PS-CFP2ExpressionMammalianPromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-amyloid-β 40/42 nanobody (R3VQ) with sortase tag
Plasmid#233217PurposeMammalian epression of anti-amyloid-β 40/42 nanobody (R3VQ) with a sortase tag for direct dye conjugation.DepositorInsertAnti-amyloid-β 40/42 nanobody (R3VQ)
TagsSortase tag, His tagExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-VP64-Puro
Plasmid#99371Purpose3rd generation lenti vector encoding dCas9-VP64 with 2A puromycin resistance marker (EF1a-dCas9-VP64-T2A-Puro-WPRE)DepositorInsertdCas9-VP64-T2A-Puro
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
miniSOG-LaminB1-10
Plasmid#57771PurposeLocalization: Nuclear Envelope, Excitation: 448 / 473, Emission: 500 / 528DepositorAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
miniSOG-Mito-7
Plasmid#57773PurposeLocalization: Mitochondria, Excitation: 448 / 473, Emission: 500 / 528DepositorAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiGuide-Hygro-dTomato
Plasmid#99376PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A dTomato from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-dTomato
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-KRAB-Puro
Plasmid#99372Purpose3rd generation lenti vector encoding dCas9-KRAB with 2A puromycin resistance marker (EF1a-dCas9-KRAB-T2A-Puro-WPRE)DepositorInsertdCas9-KRAB-T2A-Puro
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pS6-hα2M-H6
Plasmid#128495PurposeExpresses human α2M (from G27 to S1468) in mammalian cells. With C-t H6x tag.DepositorAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
miniSOG-Actin-7
Plasmid#57761PurposeLocalization: Actin, Excitation: 448 / 473, Emission: 500 / 528DepositorAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiGuide-Hygro-iRFP670
Plasmid#99377PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A iRFP670 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-iRFP670
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMYH9-D1424H-FLAG
Plasmid#183513PurposeGateway expression vector encoding D1424H mutant MYH9 cDNA, with N-terminal Flag tag. For mammalian expression.DepositorInsertMYH9 (MYH9 Human)
TagsFLAGExpressionMammalianMutationchanged Aspartic acid 1424 to HistidinePromoterCMVAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2NLS-Cas9-6XMS2
Plasmid#166033PurposeExpression of 6X MS2 stem loops fused SpCas9 mRNA for packaging of SpCas9 mRNA within lentiviral particles.DepositorInsertSpCas9
UseCRISPR and LentiviralPromoterCMVAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMR506-EF1a-H2B-EGFP
Plasmid#186627PurposeExpresses nuclear-localised EGFP under EF1a promoter. For insertion of genetic barcodes into 3'UTR of EGFP.DepositorInsertEF1a (EEF1A1 Synthetic)
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIE-hα2M-H6
Plasmid#128492PurposeExpresses human α2M (from S24 to N1473) in insect cells. With C-t H6x tag.DepositorAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mGreenLantern-KASH
Plasmid#191094PurposeTo express a bright monomeric green FP to label the eucaryotic nuclear envelope. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmGreenLantern-KASH
UseAAV and Synthetic BiologyTagsmGreenLantern fused to the KASH domain of Nesprin…ExpressionMammalianMutationOptimizzation was done using the Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHis-BRD4 BD1
Plasmid#196544PurposeExpression of BRD4 Bromodomain (BD1) in E.coliDepositorAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-H2BmGreenLantern
Plasmid#177332PurposeTo express a bright monomeric green FP to label eucaryotic cell nuclei. To be used in clearing and other fluorescent microscope methods.DepositorInsertH2B (Hist1h2bq Rat)
UseAAVTagsmGreenLanternExpressionMammalianMutationThis fusion protein was optimized to the Human co…PromoterCAGAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS2-TEV-Twin-Strep
Plasmid#202529PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 2 (SMS2) in mammalian cellDepositorInsertSGMS2 (SGMS2 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TGA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDragon-Ctgf
Plasmid#155015PurposeFor Flp-mediated cassette exchange. Expresses tdTomato in the presence of (r)tTA, switching to connective tissue growth factor in the presence of Cre and (r)tTA activity.DepositorAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-HAT
Plasmid#202557PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable HAT-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsHistidine-Affinity-tag (HAT) and TEV cleavable si…ExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-ClopHensorN-WPRE-HGHpA
Plasmid#193728PurposeCre-activated AAV expression of ClopHensorN for measuring intracellular chloride and pH in genetically-defined cell typesDepositorInsertClopHensorN
UseAAVTagsStrep-II (N terminal on insert)ExpressionMammalianPromoterEF1aAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-pTau nanobody (A2) with sortase tag
Plasmid#233218PurposeMammalian epression of anti-pTau nanobody (A2) with a sortase tag for direct dye conjugation.DepositorInsertAnti-pTau nanobody (A2)
TagsSortase tag, His tagExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgAMPKa1
Plasmid#138704PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2706-pHAGE-EF1aL-YAP5SA-UBC-GFP
Plasmid#216475Purposelentiviral dual expression of YAP5SA and eGFPDepositorInsertsYAP5SA
eGFP
UseLentiviralMutationS61A, S109A, S127A, S164A, S381APromoterEF1aL and UBCAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-rtTA2-TRE-SspB-mScarlet-I-MYPT169
Plasmid#178528PurposeExpresses rtTA and SspB-mScarlet-I-MYPT (1-169 aa) in mammalian cellsDepositorInsertrtTA, SspB-mScarlet-I-MYPT (1-169aa)
ExpressionMammalianPromoterCAG, Tet responsive elementAvailable SinceDec. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER-21-RUNX1-P2A-ERG
Plasmid#97045PurposeExpresses RUNX1-P2A-ERG in mammalian cells. *Please see notes below on P2A cleaving efficiency.DepositorInsertRunt Related Transcription Factor 1, ETS-Related Gene
UseLentiviralExpressionMammalianPromoterTet onAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only