We narrowed to 11,278 results for: AGA
-
Plasmid#228367Purposeexpress human FBXO22 in insect cells, such as Trichoplusia ni Hi5DepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pENTR-HLA-A0201-His
Plasmid#108213PurposeHLA-A0201 his taggedDepositorInsertmajor histocompatibility complex, class I, B (HLA-A Human)
UseEntry vector for gateway systemTagshisAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT1-2
Plasmid#184481PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT1-1
Plasmid#184480PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-SOX4
Plasmid#185552PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting SOX4DepositorInsertSOX4 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-ΔFbox-pcDNA3.1-
Plasmid#52502Purposeexpresses human FbxO11-ΔFbox in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertFbxO11 (FBXO11 Human)
TagsFLAG-HAExpressionMammalianMutationdeletion of Fbox (deleted aa 71-116)PromoterCMVAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
DHC1 CRISPR
Plasmid#140545PurposeDHC1 tagging CRISPRDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-ChRmine-oScarlet-WPRE
Plasmid#183524PurposeOptogeneticsDepositorInsertChRmine-oScarlet
UseAAVPromoterEf1aAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-Twin-Strep
Plasmid#202528PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNluc-sgControl
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAED2
Plasmid#234599PurposeFluorescent reporter of the SOS responseDepositorInsertsmScarlet-I
gfp-mut2
UseReporterExpressionBacterialMutationGFPmut2 was derived from avGFP with the following…PromoterPtet+dnaK P1 and cdaAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K164R)
Plasmid#72555PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK164RPromoterE1B minimal promoterAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMega-MaFRSA
Plasmid#200226PurposeThe plasmid encodes an orthogonal aminoacyl-tRNA synthetase/tRNA-CUA pair for amber codon suppression with meta-trifluoromethylphenylalanine..DepositorInsertsPyrrolysyl-tRNA synthetase
pyrrolysyl-tRNA
TagsnoneExpressionBacterialMutationmutated Asparagine 166 to Alanine and Valine 168 …PromoterproK-lacO and tacIAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Bhlhe40-3xFLAG-IRES-BFP
Plasmid#117263PurposeRetroviral overexpression of Bhlhe40 with a 3xFLAGDepositorAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-αIFNα-ab
Plasmid#110799PurposeExpression and secretion of an scFv antibody (clone) 4EA1 against all mouse interferon α subtypes in mammalian cellsDepositorInsertantibody against mouse interferon alpha
TagsER signal peptide, His6 tag, and myc epitope tagExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCold I-Hero45
Plasmid#187931PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero45DepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV p2GM AMPK alpha2hp1 alpha1hp1
Plasmid#89492PurposeshRNA against AMPK alpha2 and alpha1 in mouse/human to knock down protein expressionDepositorInsert2 hairpins against mouse/human AMPKalpha1 and alpha2
UseRetroviralExpressionMammalianPromoterU6 (The GFP-Puro is from a PGK promoter; the shRN…Available SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl2-Cb5
Plasmid#18000DepositorInsertER targeted Bcl-2 (BCL2 Human)
TagsGFPExpressionMammalianMutationBcl-2's C terminal targeting sequence replac…PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only