We narrowed to 19,041 results for: Cre
-
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
Plasmid#67974PurposeCRISPR gRNA expression vector with an improved scaffold and puro/BFP markersDepositorInsertU6gRNA cassette, PGKpuro2ABFP cassette, WPRE
UseLentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-AMBRA1-3xFLAG
Plasmid#174157PurposeVector for expression of 3xFLAG-tagged wild-type AMBRA1DepositorInsertAMBRA1 (AMBRA1 Human)
UseTags3xFLAGExpressionMammalianMutationPromoterCMVAvailable sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#2
Plasmid#174153PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorInsertAMBRA (AMBRA1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorInsertAMBRA (AMBRA1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ATF4_WT
Plasmid#82190PurposeGateway Donor vector containing ATF4 , part of the Target Accelerator Plasmid Collection.DepositorInsertATF4 (ATF4 Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-NGR-WPRE
Plasmid#234437PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
GPER-DuET
Plasmid#213256PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPER (GPER1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-ARNT
Plasmid#203578PurposeExpresses wild-type ARNT in mammalian cells.DepositorInsertARNT (ARNT Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-SMARCA4
Plasmid#65391PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertSMARCA4 (SMARCA4 Human)
UseTagsEmGFP and V5ExpressionMammalianMutationnonePromoterCMVAvailable sinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#72666PurposeLentiviral dual CRISPR gRNA expression vector (human 7SK and human U6 promoters)DepositorInserth7SKgRNA cassette, hU6gRNA cassette, PGKpuroBFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-Cas9Bsd-W
Plasmid#68343PurposeLentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the C-terminusDepositorInsertEF1a-Cas9 cassette, WPRE
UseCRISPR and LentiviralTagsCas9 fused with Flag-tag and a NLS at the N termi…ExpressionMutationPromoterEF1aAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#9 in pTwist-CMV backbone
Plasmid#216153PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells (brighter than #7). It uses a single intron. [Code 'B11']. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic splice site and C-terminal FLAG tag
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4s-NGR-WPRE
Plasmid#234451PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterCAGAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY100-RetroEFS-HER2-28BBz-WPRE
Plasmid#192201PurposeRetro-HER2CARDepositorInsertRetro-HER2CAR (ERBB2 Synthetic)
UseRetroviral; Mammalian expressionTagsExpressionMutationNAPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W
Plasmid#67977PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mCherry markersDepositorInsertU6gRNA cassette, PGKpuro2AmCherry cassette, WPRE
UseLentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-dCas9-p300-P2A-PuroR
Plasmid#83889PurposeLentiviral Sp dCas9-p300-P2A-PuroRDepositorInsertsS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, S. pyogenes, Human)
pac from Streptomyces alboniger
UseCRISPR and LentiviralTagsFlag and nucleoplasmin NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEFSAvailable sinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hHNF4alpha
Plasmid#206878PurposeThe ORF of HNF4α (variant 2) cDNA amplified from the RT human liver RNA was cloned at the Bam HI/XbaI sites of the pcDNA3.1(+), the mammalian expression vector.DepositorInsertHuman hepatocyte nuclear factor 4 alpha (HNF4A Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRBN_ΔHBD
Plasmid#232779PurposeExpresses CRBN_ΔHBD sequence in E. coli cells with cleavable MBP-His tag and deleted internal DDB1 binding domainDepositorInsertCereblon (CRBN Human)
UseTagsMBP-His6-TEVExpressionBacterialMutationCRBN (residues 47 to 193 and 249 to 436) with GNG…PromoterT7Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-EF1Alpha-puro-T2A-Tet-on 3G-TRE3G-Ascl1
Plasmid#118593PurposeExpresses a puromycin resistance cassette with Tet-on 3G from the EF1Alpha promoter and Ascl1 from the TRE3G promoterDepositorInsertPuro-T2A-Tet-on 3G/Ascl1 (Ascl1 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1Alpha/TRE3GAvailable sinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4f-NGR-WPRE
Plasmid#234452PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterCAGAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET11a_His-TEV-PLpro (nsp3) (SARS-CoV-2)
Plasmid#169192PurposeTo express SARS-CoV-2 Papain-like protease in E. coliDepositorInsert6His-TEV-nsp3_E746-K1060 (pp1ab_E1564-K1878) (ORF1ab Synthetic, SARS-CoV-2)
UseUnspecifiedTags6His-TEVExpressionMutationCodon optimised for E. coliPromoterT7Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOT_5 - lenti-EFS-FMC6.3-28z-2A-puro-2A-tNGFR
Plasmid#181974PurposeExpresses anti-CD19 CAR (with CD28 signaling domain) linked to puromycin resistance via P2A and to human truncated NGFR via T2A for lentiviral delivery.DepositorInsertFMC6.3-28z CAR; tNGFR (NGFR Synthetic, Human)
UseLentiviralTagsExpressionMutationNGFR truncation: aa 11-276PromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-JAG1-mVenus
Plasmid#171170PurposeRetroviral vector for CMV promoter driven expression of JAG1 (Notch pathway) fused to mVenus fluorescent protein (to be used in conjunction with Phoenix packaging cells).DepositorInsertJAG1 (JAG1 Human)
UseRetroviralTagsmVenusExpressionMammalianMutationPromoterCMVAvailable sinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgp53
Plasmid#227947PurposesgRNA targeting p53, GFP, neomycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorInsertTp53 (Trp53 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W
Plasmid#67979PurposeCas9 activity reporter (control) with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-bLbCas12a-NLS(nucleoplasmin)-6xHis (RTW645)
Plasmid#114070PurposeT7 promoter bacterial expression plasmid for bacterial codon optimized LbCas12a with C-terminal NLS and His-tagDepositorInsertbacteria codon optimized LbCas12a with C-terminal NLS and His-tag
UseTagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEB multi-Hyg Human collagen type IV alpha 4 chain (COL4A4)
Plasmid#229771Purpose3xFlag-tagged human Col4A4 to be used with N- or C-tagged LgBiT Col4A5 and SmBiT Col4A3 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 4 chain (COL4A4) (COL4A4 Human)
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-PDGFR-WPRE
Plasmid#234436PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#7 in pTwist-CMV backbone
Plasmid#216152PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. This plasmid has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells. It uses a cryptic exon. [Code 'A11'] Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic exon and C-terminal FLAG
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#10 in pTwist-CMV backbone
Plasmid#216154PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Leaky but very sensitive to mild TDP-43 loss of function. It uses a cryptic exon. [Code 'B5'] Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic exon and C-terminal FLAG
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-DuET
Plasmid#213221PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCXCR4 (CXCR4 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCR6-DuET
Plasmid#213202PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCCR6 (CCR6 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1 YFP
Plasmid#84912PurposeMammalian expresion of TDP-43 NLS1 YFPDepositorInsertTDP-43 (TARDBP Human)
UseTagsYFPExpressionMammalianMutationK82A, R83A, K84APromoterCMVAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.CAP-B22
Plasmid#175005Purposenon-standard AAV2 rep-AAV.CAP-B22 cap plasmid with AAV cap expression controlled by a tTA-TRE amplifcation systemDepositorInsertSynthetic construct isolate AAV.CAP-B22 VP1 gene
UseAAVTagsExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available sinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterAvailable sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-W
Plasmid#67986PurposeCas9 activity reporter with mCherry and BFPDepositorInsertsU6gRNA cassette, PGKmCherryABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Anti-ATF4 [N360A/24]
Plasmid#190315PurposeMammalian Expression Plasmid of anti-ATF4 (Human). Derived from hybridoma N360A/24.DepositorInsertanti-ATF4 (Homo sapiens) recombinant Mouse monoclonal antibody (ATF4 Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only