We narrowed to 42,127 results for: LAS
-
Plasmid#156443PurposeFor transient expression of mouse BORIS (CTCFL) tagged with eGFPDepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pKS023 - pCAGGS-3XFLAG-mKate2-Pds5b-bpA
Plasmid#156442PurposeFor transient expression of mouse PDS5B tagged with mKate2DepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKS016 - pCAGGS-3XFLAG-mKate2-Pds5a-bpA
Plasmid#156439PurposeFor transient expression of mouse PDS5A tagged with mKate2DepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
POM43-mCherry
Plasmid#69857PurposeN-terminal tagging with mCherry using LEU2 as a selection marker in S. cerevisiae.DepositorInsertmCherry minus start and stop codon
ExpressionYeastAvailable SinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
p_SNIPR_target_WT
Plasmid#139465PurposeT7 RNAP-driven expression of the cognate SNIPR trigger RNA that is complementary to the SNIPR RNA sensorDepositorInsertTarget_WT
ExpressionBacterialAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLG_GI4
Plasmid#111595PurposeGI Library VectorDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6-mTFP1-His3MX6
Plasmid#69850PurposeC-terminal tagging with mTFP1 using His3MX6 as a selection marker in S. cerevisiae.DepositorInsertmTFP1
ExpressionYeastAvailable SinceApril 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)
Plasmid#100743PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice formDepositorAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-jYCaMP1s
Plasmid#135420PurposeYellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfection, slow variantDepositorHas ServiceAAV1InsertjYCaMP1s
UseAAVExpressionMammalianPromoterhSynAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-H2B-jGCaMP8m-WPRE
Plasmid#176748PurposeAAV-mediated expression of histone fused GCaMP8m under the synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertH2B-jGCaMP8m
UseAAVExpressionMammalianPromotersynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-OC43-Spike
Plasmid#168951PurposeGateway-compatible Entry vectorDepositorInsertHCoV-OC43-Spike (S )
UseGateway CloningAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMB1_1R26PylRS(CbzK)_AfTyrRS(p-I-Phe)_AlvtRNA-ΔNPyl(8)(CGA)_AftRNA-Tyr(A01)(CUA)
Plasmid#174516PurposeRecoded double aaRS/tRNA plasmid with 1R26PylRS/AlvtRNA-ΔNPyl(8)(CGA) & AfTyrRS/AftRNA-Tyr(A01)(CUA) to incorporate CbzK into the TCG codon & p-I-Phe into the TAG codon.DepositorInsertsPylS_1R26 - CBZK
Af_TyrRS - p-I-Phe
Ma tRNA pylT(8) with CGA anticodon
A.fulgidus tRNA with CUA anticodon
ExpressionBacterialMutationCUA anticodon, M.alvus Pyl tRNA with CGA anticodo…PromoterGlnS and lppAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N3-EPAC1
Plasmid#113110PurposeHuman EPAC1 gene was fused in-frame and upstream from the enhanced YFP gene in pEYFP-N3 vector (Clonetech).DepositorAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMR506-EF1a-H2B-EGFP
Plasmid#186627PurposeExpresses nuclear-localised EGFP under EF1a promoter. For insertion of genetic barcodes into 3'UTR of EGFP.DepositorInsertEF1a (EEF1A1 Synthetic)
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-ANLN
Plasmid#31203DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-PpAPOBEC1 H122A
Plasmid#138338PurposeMammalian expression plasmid for BE4-PpABOBEC1H122ADepositorInsertBE4-PpAPOBEC1 H122A
UseSynthetic BiologyTagsBP-NLSMutationChange of His122 to Ala.PromoterCMVAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1329 - pAAV EF1a HA-hM4D(Gi)
Plasmid#89150PurposeAn AAV packaging plasmid that expresses HA-tagged hM4D(Gi) inhibitory DREADD from the EF1a promoter.DepositorInserthM4D(Gi)
UseAAVTagsHAExpressionMammalianPromoterEF1aAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14101 aeBlue
Plasmid#239453Purposeexpress aeBlue chromoproteinDepositorInsertaeBlue
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only