We narrowed to 13,602 results for: sequence
-
Plasmid#126762PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-SpCas9-HF1 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than SpCas9HF1.DepositorInsertB-SpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; Q926A; amino acids 1005-1013…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT2
Plasmid#127512PurposePlasmid encodes H. sapiens codon optimized Integrase 2.DepositorInsertIntegrase 2 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT9
Plasmid#127516PurposePlasmid encodes H. sapiens codon optimized Integrase 9.DepositorInsertIntegrase 9 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT13
Plasmid#127517PurposePlasmid encodes H. sapiens codon optimized Integrase 13.DepositorInsertIntegrase 13 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMC059-HisMS2_PLP_NucPhos_pac
Plasmid#155039PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Nucleocapsid Phosphoprotein geneDepositorInsertsMaturation Protein
Coat Protein Dimer
Nucleocapsid Phosphoprotein
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
mMib1-FLAG
Plasmid#37116DepositorInsertMib1(Mus musculus mindbomb homolog 1 (Drosophila) (Mib1)) (Mib1 Mouse)
Tags3 x FLAGExpressionMammalianMutationACC Kozak sequence added before ATG annotated.PromoterCMVAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
BmR1_04g07470-bio-His
Plasmid#108037PurposeExpresses enzymatically monobiotinylated full-length BmR1_04g07470 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBmR1_04g07470
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…Available SinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCAP03-sp44/p21
Plasmid#120232PurposeCarries bidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites that can be amplified with homology sequence for refactoring.DepositorInsertbidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites
UseSynthetic BiologyMutationaac(3)IV (apramycin resistance gene)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SGFP2-CTNNB1
Plasmid#153430PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SGFP2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSGFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-WT (AF41)
Plasmid#21367DepositorInsertautosomal dominant polycystic kidney disease type I (PKD1 Human)
TagsEGFP and FLAGExpressionMammalianMutationwild-type sequence*Available SinceDec. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pFastbac1-GST-hUSP7
Plasmid#63573PurposeExpression of synthetic human USP7 tagged with GSTDepositorInsertUSP7 (USP7 Synthetic, Human)
TagsGSTExpressionInsectMutationSynthetic based on human protein sequence (please…PromoterPolyhedrinAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Plxna3-Fc-His
Plasmid#72124PurposeExpresses the extracellular region of the PlexinA3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET21a Ce-iPGM-bio
Plasmid#162559PurposeExpresses C. elegans iPGM containing a C-terminal biotinylation site and His tagDepositorInsertC. elegans iPGM bio-6His (ipgm-1 Nematode)
Tags6His tag, T7 tag, Thrombin cleavage site, and bio…ExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21a Bm-iPGM-bio
Plasmid#162565PurposeExpresses B. malayi iPGM containing a C-terminal biotinylation site and His tagDepositorInsertB. malayi iPGM bio-6His
Tags6His tag, T7 tag, biotinylation sequence, and thr…ExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
B-Sniper SpCas9
Plasmid#207361PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-Sniper SpCas9
UseCRISPRTags3xFLAGExpressionMammalianMutationF539S, M763I, K890N, amino acids 1005-1013 replac…PromoterCBhAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
proE-cad178-Luc-mEbox
Plasmid#42082DepositorInsertE-cadherin (CDH1 Human)
UseLuciferaseExpressionMammalianMutationcontains E-cadherin promoter region from -178 to …PromoterE-cadherinAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_Wild-type
Plasmid#234551PurposeHuman a-Ecat sequence/CTNNA1DepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GalNAc-T2-GFP-ESCargo(FTV)
Plasmid#140163PurposeExpresses a regulatable secretory cargo for mammalian cells and a Golgi markerDepositorInsertGalNAc-T2-msGFP2 and piGH-FTVNTT-DsRed-Express2-FKBP(LV)(C22V) (GALNT2 Synthetic, Human)
TagsER signal sequence (MGWSCIILFLVATATGAHS) (N termi…ExpressionMammalianPromoterEF-1aAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIHEU-FlipGFP(Casp3 cleavage seq) T2A mCherry
Plasmid#124434PurposeExpresses FlipGFP (caspase-3 cleavage sequence) and T2A mCherry in DrosophilaDepositorInsertFlipGFP(Casp3 cleavage seq) T2A mCherry
ExpressionInsectAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
Plxnd1-Fc-His
Plasmid#72132PurposeExpresses the extracellular region of the PlexinD1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LpIA(wild-type)
Plasmid#61821PurposeEncodes a wild-type sequence of LplA and serves as the negative control for resorufin labelingDepositorInsertE. coli lipoic acid ligase
Tags6XHis, EGFP, and FlagExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-iGECI-NES
Plasmid#160424PurposeAAV plasmid for CaMKII-driven expression of a genetically-encoded calcium indicator iGECI with a nuclear export signal sequenceDepositorInsertiGECI-NES
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTT3 Flrt1-myc
Plasmid#72191PurposeExpress full-length Flrt1 with a C-terminal myc tagDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-cmyc-natT1R2
Plasmid#113946Purposemammalian expression plasmid for c-myc-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R2 (TAS1R2 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-GRM3-VN
Plasmid#98965PurposeFLAG-tagged human mGluR3 fused to N-terminus of split VenusDepositorInsertGRM3 (GRM3 Human)
TagsFLAG (dykddddk) epitope tag, Signal/leader sequen…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG876 pDisplay-pFAST
Plasmid#172868Purposeexpresses pFAST at the surface of mammalian cellsDepositorInsertpFAST-PDGFR
TagsIgK leader sequence (N terminal on insert) and My…ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only