We narrowed to 10,769 results for: ESP
-
Plasmid#169264PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 8DepositorInsertNop4 delta E8 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-pAce-Kv2.1PR
Plasmid#195523PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of synapsin promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterSynapsinAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-pAce-Kv2.1PR
Plasmid#195529PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEXm-hCD45d
Plasmid#247052PurposeFor mammalian expression of human CD45 domains 1 and 2 with C-terminal Maltose-Binding Protein fusion for secretion into the mediumDepositorInserthCD45d1d2-MBP
TagsHis6 and Maltose binding protein (MBP)ExpressionMammalianMutationDomains 1 and 2 only, corresponding to residues 2…Promoterchick β-actin promoterAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLX_305_Ovalbumin
Plasmid#184924PurposeLentiviral vector for expressing Ovalbumin. Also expresses the puromycin resistance gene as a selectable marker.DepositorInsertOvalbumin (OVAL Chicken)
UseLentiviralExpressionMammalianMutationOur vector has an A188T mutation that does not im…PromoterPGKAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ERT2-iCre-ERT2
Plasmid#178059PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under Syn promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman synapsin 1 (Syn) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-8xGTIIC-mScarlet-NLS-PEST
Plasmid#249724PurposeNuclear-localized fluorescent reporter of YAP/TAZ activity driven by promoter with TEAD binding sitesDepositorInsertYAP-TEAD responsive promoter (YAP1 Human)
UseLentiviralTagsmScarlet3-NLS-PESTExpressionMammalianAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244092PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mRuby3
Plasmid#244101PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244084PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(mem).iGlucoSnFR2.mRuby3
Plasmid#244089PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-SRRM2-mCherry
Plasmid#174089PurposeInducibly expresses SRRM2-mCherry in mammalian cells with the Tet-on systemDepositorAvailable SinceSept. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-ERT2-iCre-ERT2
Plasmid#178060PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under UBC promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HRE-dUnaG
Plasmid#124372PurposeUnaG fluorescent protein reporter for hypoxia-induced factor (HIF) signalingDepositorInsertHRE-dUnaG
UseLentiviralTagsPEST-degron and Myc tagPromoterHRE (HIF responsive element 5x + CMV minimal prom…Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.1.t1
Plasmid#73547PurposetRNA synthetase/tRNA pair for the in vivo incorporation of p-azido-l-phenylalanine, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.1.t1
pAzFRS.1.t1
ExpressionBacterialAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lox-stop-Lox p53 R172H
Plasmid#14854DepositorInsertp53 R172H (Trp53 Mouse)
UseCre/LoxTagsLox-STOP-loxExpressionMammalianMutationStructural mutant R172H. (Murine p53 codon 172 co…Available SinceApril 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1b-ST-WPRE
Plasmid#214967PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for brighter fluorescenceDepositorInsertCepheid1b-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.2.t1
Plasmid#73546PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.2.t1
pAzFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1s-ST-WPRE
Plasmid#214968PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for better photostabilityDepositorInsertCepheid1s-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lox-stop-Lox p53 R270H
Plasmid#14853DepositorInsertp53 R270H (Trp53 Mouse)
UseCre/LoxTagsLox-STOP-loxExpressionMammalianMutationContact mutant R270H. (Murine p53 codon 270 corre…Available SinceApril 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-CMV-GRAB_LoX3-mut
Plasmid#234651PurposeThis plasmid encodes a mutated version of the genetically encoded chemokine biosensor LoX3-1.0, which is designed to be non-responsive to chemokine binding.DepositorInsertGPCR activation-based mutant chemokine CXCL9-11 sensor GRAB_LoX3-mut
ExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
XRE-H2B-eGFP
Plasmid#182294PurposeFluorescent reporter for AhR activityDepositorAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244102PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNTI647 dCas9-Mxi1 TetR KanMX
Plasmid#139474PurposeIntegrates CRISPRi effector and tet-responsive regulatorDepositorInsertsdCas9-Mxi1
Tet Repressor
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1 and pTEF1Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pANAP-P2A-eRF(E55D)
Plasmid#241290PurposeAllows co-translational incorporation of the fluorescent ncAA Anap directly into the target protein; expresses tRNACUA-Leu, AnapRS, and dominant negative ribosomal release factorDepositorInsertthe amber suppressor tRNACUA-Leu
ExpressionMammalianMutationmutant E.coli leucyl synthetase specific for Anap…PromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-5HRE-GFP PuroR
Plasmid#128958PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only