We narrowed to 2,388 results for: control GFP
-
Plasmid#66061PurposeMoClo Device: FACS Standard Color Controls - High GFP (first unit) & RFP (second unit) expression cassette - Ampicillin plasmid [A:J23102:B:BCD2:C:E0040m:D:B0015:E:J23102:B:BCD2:C:E1010m:D:B0015:F]DepositorInsertFACS Controls
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ02B2Rm:Gm_AF
Plasmid#66062PurposeMoClo Device: FACS Standard Color Controls - High RFP (first unit) & GFP (second unit) expression cassette - Ampicillin plasmid [A:J23102:B:BCD2:C:E1010m:D:B0015:E:J23102:B:BCD2:C:E0040m:D:B0015:F]DepositorInsertFACS Controls
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSR04
Plasmid#69151Purposeread-outloxP mCherry to GFP switch, with eft-1::tagBFP::tbb-2UTR as gene of interest for integration on cxtTi10816, Mos Chr IVDepositorInsertsmCherry
TagBFP
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promotereef-1A.1 (eft-3) and rps-27Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
908I
Plasmid#160241PurposeVanO(2x)-Hsp70min-UASpmin-Firefly-T2A-eGFP-p10-3’UTR-SV40-Ubiquitin-Renilla-attBDepositorInsertsVan Operator (2x)
hsp70 minimal promoter
p-element promoter
Firefly luciferase
Renilla luciferase
Ubiquitin promoter
TagsT2A GFPExpressionInsectAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDUP1
Plasmid#223516Purposeinactive cogfp under control of Ptet, cogfp under control of PtacDepositorInsertsCoGFP
CoGFP inactivated
TagsHis tagExpressionBacterialMutationanti-dimerization mutations S129G, 22 C154S, D156…PromoterPtac, Ptac and Ptet, and PtetAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDUP2
Plasmid#223517Purposecogfp copy 1 under control of Ptet, cogfp copy 2 under control of PtacDepositorInsertsCoGFP
CoGFP (second copy)
TagsHis tagExpressionBacterialMutationanti-dimerization mutations S129G, 22 C154S, D156…PromoterPtac, Ptac and Ptet, and PtetAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
phTERT-cp PS Intein tTA
Plasmid#242032PurposeBlue-light-controlled, hTERT-promoter-driven release of the tTA transactivator from cytoplasm to nucleus.DepositorInsertCp PS Intein tTA
ExpressionMammalianMutationThe CMV promoter was replaced with the hTERT prom…PromoterhTERTAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pRBBm34
Plasmid#48114PurposeExpression of the gfp gene under control of the native xylose inducible promoter of Bacillus megateriumDepositorInsertgfp
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUASTattB-2xFlag-mCherry-Msp300KASH
Plasmid#170807PurposeExpresses Msp300 KASH domain fused to 2xFLAG and mCherry under Gal4/UAS control for Drosophila transgenesisDepositorInsert2xFLAG/mCherry-Msp300KASH
Tags2xFLAG-mCherry and Msp300KASHExpressionInsectPromoter5xUAS + hsp70 minimal promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJWV25
Plasmid#61045PurposeTo construct N-terminal GFP fusions under control of a Zn2+ inducible promoter, integrates via double crossover at bgaADepositorTypeEmpty backboneUseSynthetic BiologyTagsGFP+ExpressionBacterialAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPotef-LN22*-3xGNLS-cbx
Plasmid#86780PurposeExpresses lambda N protein fused to triple Gfp coupled to an NLS sequence under the control of the constitutively active Potef promotor.DepositorInsertLN*
UseUstilago maydis expressionTagsGfpExpressionBacterialPromoterPotefAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-PS Intein
Plasmid#242020PurposeAAV version of PS Intein palsmid.DepositorInsertPS Intein
UseAdenoviralTagsmEGFPExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNF-KB-Split PS Intein-C tTA
Plasmid#242035PurposeC-terminal segment of a blue-light-controlled split PS Intein tTA gene expression system, co-expressing mCherry under an NF-KB-inducible promoterDepositorInsertSplit PS Intein-C tTA
TagsmCherryExpressionMammalianMutationThe CMV promoter in the original vector was repla…PromoterNF-KBAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pEutRwc
Plasmid#216334PurposeAn IPTG-inducible promoter controlling expression of eutR; PEutS, extended controlling expression of sfgfpDepositorInsertsEutR
Superfolder green fluorescent protein
ExpressionBacterialAvailable SinceDec. 23, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJBL6721
Plasmid#139152PurposePDNsp1 - TARGET8 - sfGFPDepositorInsertsfGFP
ExpressionBacterialMutationN/AAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJBL6722
Plasmid#139153PurposePstabilized - TARGET8 - sfGFPDepositorInsertsfGFP
ExpressionBacterialMutationN/AAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMX229
Plasmid#23002DepositorAvailable SinceFeb. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
JBL6401
Plasmid#183838PurposesfGFP reporter under the control of WT E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-3
Plasmid#236474PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the ScACT1 promoter and 3xGFP under control of the ApACT1 promoter.DepositorInsertscACT1p-3xmCherry apACT1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-4
Plasmid#236475PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the ScACT1 promoter and 3xGFP under control of the ApTUB1 promoter.DepositorInsertscACT1p-3xmCherry apTUB1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-2
Plasmid#236473PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the SpH2B promoter and 3xGFP under control of the ScACT1 promoter.DepositorInsertspH2Bp-3xmCherry scACT1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHH29_32 series plasmid
Plasmid#120901PurposeAlso known as pHH29_32_HG27, one of the pHH29_32 series plasmids. The component plasmid of a unregulated or a regulated deviceDepositorInsertsEc-TTL-P109
sRNA-A targeting sequence
RBS TIR=974 of GFPop1 gene
GFPop1
RBS TIR=6474 of ECF32mut gene
ECF32mut
T7 terminator
resource competitor
UseSynthetic BiologyExpressionBacterialAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHES943
Plasmid#112641Purposeyeast mating pheromone response pathway reporterDepositorInsertyeGFP
ExpressionYeastPromoterAGA1Available SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTN4
Plasmid#174212PurposeDonor plasmid for introducing Peft-3::AtTIR1(F79G)::mRuby at the ttTi5605 locusDepositorAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA3
Plasmid#113132PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 3 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA4
Plasmid#113133PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 4 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, Synthetic Biology, and TALENExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA2
Plasmid#113131PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
negAKARet-cyto
Plasmid#114733PurposeNegative control of AKARet-cytoDepositorInsertNegative Control of AKARet-cyto
TagsEGFP and sREAChetExpressionMammalianPromoterCMVAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
negEKARet-cyto
Plasmid#114734PurposeNegative control of EKARet-cytoDepositorInsertNegative Control of EKARet-cyto
TagsEGFP and sREAChetExpressionMammalianPromoterCMVAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Split PS Intein
Plasmid#242022PurposeBlue-light-induced reconstitution of split mCherry. A T2A peptide is inserted at the natural split site of gp41-1.DepositorInsertSplit PS Intein
TagsmEGFPExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCKtheoRaj12-olsa
Plasmid#69940PurposepSTC2,theoHHAzRaj12,cisRaj12-sfGFP, KanRDepositorInsertsTheoHHAzRaj12,cisRaj12,sfGFP
theoHHAzRaj12,cisRaj12-sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cyto_K20
Plasmid#133862PurposeExpression of cytoplasmic Ribosome stalling reporterDepositorInsertCyto_K20
TagsEGFP and RFPExpressionMammalianPromoterCMVAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
ER_K20
Plasmid#133861PurposeExpression of ER-targeted Ribosome stalling reporterDepositorInsertER_K20
TagsEGFP and RFPExpressionMammalianPromoterCMVAvailable SinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cyto_K0
Plasmid#133864PurposeExpression of cytoplasmic Ribosome non-stalling reporterDepositorInsertCyto_K0
TagsEGFP and RFPExpressionMammalianPromoterCMVAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
ER_K0
Plasmid#133863PurposeExpression of ER-targeted Ribosome non-stalling reporterDepositorInsertER_K0
TagsEGFP and RFPExpressionMammalianPromoterCMVAvailable SinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMX231
Plasmid#23003DepositorAvailable SinceFeb. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
LZRS-GATA3
Plasmid#34836DepositorAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
JBL6423
Plasmid#183860PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Incumbent Rescue A regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6424
Plasmid#183861PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Invader B regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6427
Plasmid#183864PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Incumbent B regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6428
Plasmid#183865PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Incumbent Rescue B regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6410
Plasmid#183847PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch delta90-94 regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6411
Plasmid#183848PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch delta95-99 regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only