We narrowed to 5,988 results for: crispr cas9 expression plasmids
-
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianMutationPromoterhuman U6Available sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pCFD3-ebony
Plasmid#83380PurposeDrosophila gRNA expression plasmid targets ebonyDepositorInsertebony (e Fly)
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN501
Plasmid#50582PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Bar resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationCas9D10A nickase, was derived from the zCas9 and …PromoterAtU6-26p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
HCP9
Plasmid#166111PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Hta2DepositorInsertHta2-sg18 (HTA2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_206
Plasmid#96920Purposefor SaCas9 knockout, lentiviral expression of S. aureus Cas9 (SauCas9) and gRNA scaffoldDepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP2292
Plasmid#70707PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available sinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2253
Plasmid#70704PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available sinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgRNA expression vector
Plasmid#51132PurposeFor in vitro transcription of sgRNA from the T7 promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterT7Available sinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFOXA3.1.0-gDNA
Plasmid#112417PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXA3DepositorInsertFOXA3 (FOXA3 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNR2F1.1.0-gDNA
Plasmid#112484PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NR2F1DepositorInsertNR2F1 (NR2F1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pELF4.1.0-gDNA
Plasmid#112467PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ELF4DepositorInsertELF4 (ELF4 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA
Plasmid#99698PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA with BsaI cloning sites for programming, vector allows for strong activation of programmed target gene, can be packaged and delivered as AAVDepositorTypeEmpty backboneUseAAVTagsExpressionMutationPromoterAvailable sinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS328
Plasmid#73717PurposeC. elegans germline CRE expression vectorDepositorInsert2xNLS-CRE
UseCre/LoxTagsExpressionWormMutationPromoterPeft-3Available sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSQT817
Plasmid#53373Purposewildtype Cas9 expression plasmidDepositorInsertCas9
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceJuly 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianMutationPromoterCMV and U6Available sinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1-CyOFP1
Plasmid#124771Purpose3rd generation lentiviral plasmid to co-express a guide RNA and CyOFP1DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1-mOrange
Plasmid#124772Purpose3rd generation lentiviral plasmid to co-express a guide RNA and mOrangeDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_NANOG
Plasmid#64153PurposePhotoactivatable transcription system. Lentiviral expression of NANOG sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA1_NANOG (NANOG Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4_NANOG
Plasmid#64156PurposePhotoactivatable transcription system. Lentiviral expression of NANOG sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA4_NANOG (NANOG Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_NANOG
Plasmid#64155PurposePhotoactivatable transcription system. Lentiviral expression of NANOG sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA3_NANOG (NANOG Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_NANOG
Plasmid#64154PurposePhotoactivatable transcription system. Lentiviral expression of NANOG sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA2_NANOG (NANOG Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
UseTagsExpressionYeastMutationPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-mClover3-Puromycin
Plasmid#167205PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with mClover3 and selection with PuromycinDepositorTypeEmpty backboneUseCRISPRTagsmClover3ExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-HaloTag-Puromycin
Plasmid#167208PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with HaloTag and selection with PuromycinDepositorTypeEmpty backboneUseCRISPRTagsHaloTagExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-mRuby3-Zeo
Plasmid#167206PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with mRuby3 and selection with ZeocinDepositorTypeEmpty backboneUseCRISPRTagsmRuby3ExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-mTagBFP2-Blasticidin
Plasmid#167207PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with mTagBFP2 and selection with BlasticidinDepositorTypeEmpty backboneUseCRISPRTagsmTagBFP2ExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-NanoLuc-Puromycin
Plasmid#167209PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with NanoLuc and selection with PuromycinDepositorTypeEmpty backboneUseCRISPRTagsNanoLucExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpRY-His
Plasmid#179320PurposePlasmid for bacterial expression and purification of SpRY-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpRY
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…PromoterAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpG-His
Plasmid#179318PurposePlasmid for bacterial expression and purification of SpG-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpG
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RPromoterAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only