We narrowed to 41,928 results for: TRO
-
Plasmid#225443PurposeGeminino 2.0-no ATG on CDS. BeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1.DepositorInsertBeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMY-Lyz2-GSG-mCherry
Plasmid#163346PurposeRetroviral vector to express C-terminally mCherry-tagged murine Lyz2DepositorAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-mcherry-2a-CDK2-D145N
Plasmid#121132Purposeneutrophil specific expressionDepositorInsertdre-D145N CDK2 DN (cdk2 Zebrafish)
Tagsmcherry-2aExpressionBacterialMutationD145N point mutation DNPromoterneutrophil specific lyzCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Sense
Plasmid#124443PurposePlasmid for sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRA/PINCO
Plasmid#108938PurposeRetroviral expression of mRIN2 dRADepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationDeletion of RA domain (aa 751-836)PromoterLTRAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRHVPS9/PINCO
Plasmid#108939PurposeRetroviral expression of mRIN2 dRHVPS9DepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationDeletion of RHVPS9 domain (aa 455-738)PromoterLTRAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDX2 ObLiGaRe Donor vector/EPB64
Plasmid#90017PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to CDX2 exon1 locusDepositorInsertMCS flanked by inverted CDX2 ZFN binding sites (CDX2 Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB-FLAG-hDIXDC1-L-S592A
Plasmid#61225PurposeRetrovirus expressing long isoform of human DIXDC1DepositorAvailable SinceMarch 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Hygro-FLAG-hDIXDC1 S592A
Plasmid#61214PurposeRetrovirus expressing long isoform of human DIXDC1DepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
nes714Δ1388-1507tk/lacZ
Plasmid#47616Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation714 bp from 3' end of 2nd intron with a dele…PromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pvPE-V4
Plasmid#240288PurposeEncodes fourth generation porcine endogenous retrovirus-derived prime editing (pvPE) system into mammalian cells for gene editing.DepositorInsertpvPE-V4
UseCRISPRTagsSV40 NLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF140_Gag-SpyCas9-NLS
Plasmid#225959PurposeCMV-Intron-Gag-SpyCas9-NLS. Expresses Gag-SpyCas9-NLS for VLP production.DepositorInsertCMV-Intron-Gag-SpyCas9-NLS
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF160_VSV-G
Plasmid#225963PurposeCMV-Intron-VSVG (env protein). Expresses VSV-G env for VLP production.DepositorInsertCMV-Intron-VSVG (env protein)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL21-VEX
Plasmid#158230PurposeRetroviral expression plasmid of sgRNA with violet-excited fluorescent protein (VEX)DepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
BM00654
Plasmid#155339PurposeBinary vector for expression of PULSE system (under the control of CaMV35S promoter) controlling FLuc. It constitutively expresses RLuc and a plant selection cassette.DepositorInsertRB_KanR_Tnos-NLS-PIF6-E-P35S_Tnos-RLuc-PUbi10_Tnos-NLS-VP16-PhyB-P35S_Tnos-EL222-NLS-SRDX-P35S_T35S-FLuc-POpto_LB
UseLuciferase and Synthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
BM00369
Plasmid#155338PurposeBinary vector for expression of PULSE system (under the control of CaMV35S promoter) controlling GUS. It constitutively expresses dsRed and a plant selection cassette.DepositorInsertRB_KanR_Tnos-NLS-PIF6-E-P35S_Tnos-dsRed-PUbi10_Tnos-NLS-VP16-PhyB-P35S_Tnos-EL222-NLS-SRDX-P35S_T35S-GUS-POpto_LB
UseSynthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SspB-HaloTag-p63DH
Plasmid#176129PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
UseLentiviralAvailable SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5E-Runx1+23
Plasmid#69602PurposeRunx1 +23 kb intronic enhancer from mouse and beta-globin minimal promoter in a 5' entry vector for gateway cloningDepositorInsertsUse5' gateway entry vectorPromoterC57/BL6 mouse Runx1 +23 intronic enhancer and C57…Available SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SSpB-iRFP-p63DH
Plasmid#176120PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-LacI
Plasmid#103814PurposeBLInCR 'Localizer' construct that marks lacO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationLacI: C19T (silent, L7L), T264C (silent, A88A), C…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV[Tet]-Puro-TRE3G>mMyod1[NM_010866.2]
Plasmid#184380PurposeThe mouse Myod1 gene is expressed under a doxcycline-inducible TRE3G promoterDepositorInsertMyod1 (Myod1 Mouse)
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
sFlt1-i13 V5
Plasmid#86044Purposehuman Soluble Flt1 isoform i13 (terminates in intron 13)DepositorInserthuman soluble Flt1 isoform i13 (FLT1 Human)
Tags6xHis and V5ExpressionMammalianMutationisoform i13 (terminates in intron 13)PromoterCMVAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pvPE-V2
Plasmid#240286PurposeEncodes second generation porcine endogenous retrovirus-derived prime editing (pvPE) system into mammalian cells for gene editing.DepositorInsertpvPE-V2
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pvPE-V3
Plasmid#240287PurposeEncodes third generation porcine endogenous retrovirus-derived prime editing (pvPE) system into mammalian cells for gene editing.DepositorInsertpvPE-V3
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B
Plasmid#232000PurposeBicistronic expression of CHMP2B along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SL
Plasmid#111389PurposeAAV vector with hSynapsin promoter, Cre-ON ChETA-mRuby2 (for optogenetic activation), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsChETA-mRuby2
W3SL
UseAAVTagsmRuby2ExpressionMammalianMutationW3SL is built from a shortened WPRE, an upstream …PromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_sgCtrl#1
Plasmid#174148PurposeLentiviral vector expressing Cas9 and a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHL-H1-ccdB-mEF1a-RiH
Plasmid#60601PurposeCloning vector for CRISPR-sgRNA (into the BamHI-EcoRI site), expresses RFP and hygromycin resistance gene.DepositorInsertsRed Fluorescent Protein
Hygromycin resistance gene
UseCRISPRExpressionMammalianAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9-iP-A
Plasmid#60599PurposeExpresses human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorInsertCRISPR Cas9
UseCRISPRExpressionMammalianMutationCodon usage optimized for human usageAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
Plasmid#111393PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgCtrl#1
Plasmid#174142PurposeLentiviral vector expressing a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPRE
Plasmid#111388PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_sgCtrl#2
Plasmid#174149PurposeLentiviral vector expressing Cas9 and a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SSpB-HaloTag-p63DH
Plasmid#176116PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
SSpB-mCherry-p63DH
Plasmid#176112PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-OptoTGFBRs
Plasmid#118965PurposeRetroviral expression OptoTGFBRs for transient or stable constitutive expressionDepositorAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARMET-bio-His
Plasmid#52026PurposeExpresses full-length Mesencephalic astrocyte-derived neurotrophic factor precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertARMET (MANF Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-hTRF2-tagRFP-T
Plasmid#103812PurposeBLInCR 'Localizer' construct that marks telomeres and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorExpressionMammalianMutationhTRF2: deletion of amino acids 1-42 and 476 compa…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROF346
Plasmid#155331PurposeBinary vector for expression of PULSE system (under the control of AtUbi10 promoter) controlling Venus-H2B. It constitutively expresses Cerulean-NLS and a plant selection cassette.DepositorInsertRB_KanR_Tnos-NLS-PIF6-E-PUbi10_Tnos-nCerulean-PUbi10_Tnos-NLS-VP16-PhyB-PUbi10_Tnos-EL222-NLS-SRDX-PUbi10_T35S-nVenus-POpto_LB
UseSynthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A-HA-Jag1
Plasmid#46052DepositorAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Gli3_Anti-Sense
Plasmid#124440PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mOrange2-NEDD1-gTBD
Plasmid#196858PurposeExpression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange. Used to displace endogenous gamma-TuRC from the centrosome.DepositorInsertmOrange2-N-gTBD (NEDD1 Human)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-EGFP-NEDD1-gTBD
Plasmid#196857PurposeExpression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to enhanced (E) GFP. Used to displace endogenous gamma-TuRC from the centrosome.DepositorInsertEGFP-N-gTBD (NEDD1 Human)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{ChETA}on-WPRE
Plasmid#111387PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only