We narrowed to 4,490 results for: GCA
-
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOsU3-esgRNA
Plasmid#115629Purposeexpression esgRNA in rice protoplastsDepositorInsertOsU3p-esgRNA
UseCRISPRAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-RFP657-CASP8
Plasmid#75164PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8DepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR/U6 HDAC4 shRNA
Plasmid#32220DepositorAvailable SinceSept. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pWT055e
Plasmid#96866PurposesgRNA-EMX1DepositorInsertsgRNA-EMX1
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
POLR2A-N CRISPR pX330
Plasmid#124495PurposeA CRISPR plasmid for targeting the N-terminus coding region of human POLR2ADepositorInsertPOLR2A targeting CRISPR
UseCRISPRPromoterU6 promoterAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA NIA TLS1
Plasmid#196980PurposeExpresses two gRNAs targeting Arabidopsis NIA1 gene for knockout. Each gRNA is fused to TLS1 mobility signal that confers graft mobility.DepositorInsertAtNIA1 gRNAs fused to TLS1 tags
ExpressionPlantPromoterpU6-26, pU6-29Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTorPE-G-GECO1.1
Plasmid#32467DepositorInsertG-GECO1.1
UseLab constructedTags6 His tag and Modified TorA MNNNDLFQASRRRFLAQLG[G…ExpressionBacterialMutationGCaMP3 K69E/N77Y/D86G/K119I/L173Q/K380N/S404G/E43…Available SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBB75-ncRNA
Plasmid#194087PurposeExpresses Ec86 ncRNA in Escherichia coliDepositorInsertEc86 ncRNA
PromoterT7Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_hygro_3xflag_NRF2(RR)
Plasmid#136535PurposeLentiviral expression vector for an inducible 3xflag-tagged NRF2(a1584c_a1586t_a1589g)DepositorInsertNRF2(1584A>C,1586A>T,1589A>G) (NFE2L2 Human)
UseLentiviral; Destinatioin vector for gateway cloni…Tags3x FLAGExpressionMammalianMutationThis plasmid is developed by mutating 3 base pair…Available SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-LUCI-GECO1
Plasmid#113675PurposeGenetically-encoded ratiometric bioluminescent Ca2+ indicator based on GCaMP6sDepositorInsertLUCI-GECO1
ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2a/Cre
Plasmid#89644PurposeExpresses a Cdkn2a-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001146919)
Plasmid#76702Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 metaxin 1
Plasmid#12418DepositorInsertmetaxin (Mtx1 Mouse)
ExpressionMammalianAvailable SinceOct. 23, 2006AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12C/sgKras/Cre
Plasmid#99850PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only